Did you restate the hypothesis (or prediction) you formulated before the experiment?

Answers

Answer 1

Answer:

Restate your hypothesis and then state clearly and concisely whether or not your hypothesis has been supported by the experiment.


Related Questions

100 ponits!!!
Mafic rocks are...
a.high in silica content
b.low in Fe & Mg content
c.high in Fe & Mg content
d.low in silica content

Answers

Answer:

B

Explanation:

YOOOOOOOOOOOOOOOOOOOOOO

ELETSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

A substance only composed of one kind of atom is a(n) *

Answers

Element is your answer

Explanation it is on the periodic table

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

Please hurry
1. Identify one environmental factor that could cause a base sequence in DNA to be changed to a different base sequence.

2. Explain why, in a mammal, a mutation in a gamete may contribute to change in the population of the organism while a mutation a body cell will not.

Answers

Answer:

Explanation:

1     Long term exposure to harmful genotoxic chemicals or ionizing radiation can cause changes in the base sequence of DNA.Chemicals might induce DNA mutations, such as polycyclic hydrocarbons (fumes found in oil stations, or smoke from a tobacco cigarette), intercalating agents such as Ethidium Bromide (carcinogen), but also radiations such as UV-radiation (C and T bases are most vulnerable and would bind to identical bases unstead of their

2    Genetic changes that are described as de novo (new) mutations can be either hereditary or somatic. In some cases, the mutation occurs in a person’s egg or sperm cell but is not present in any of the person’s other cells. In other cases, the mutation occurs in the fertilized egg shortly after the egg and sperm cells unite. (It is often impossible to tell exactly when a de novo mutation happened.) As the fertilized egg divides, each resulting cell in the growing embryo will have the mutation. De novo mutations may explain genetic disorders in which an affected child has a mutation in every cell in the body but the parents do not, and there is no family history of the disorder.

Somatic mutations that happen in a single cell early in embryonic development can lead to a situation called mosaicism. These genetic changes are not present in a parent’s egg or sperm cells, or in the fertilized egg, but happen a bit later when the embryo includes several cells. As all the cells divide during growth and development, cells that arise from the cell with the altered gene will have the mutation, while other cells will not. Depending on the mutation and how many cells are affected, mosaicism may or may not cause health problems.

Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule? What happens to the other 66%?

Answers

Answer:

Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule is because of  the process of cellular respiration. And what happens to the other 66% is that it's  used to make water from hydrogen ions and oxygen that converted to heat and used directly for energy to store as fat

Explanation:

Give two examples of why water is important to the human body.

Answers

Answer: Your body uses water in all its cells, organs, and tissues to help regulate temperature and maintain other bodily functions. Because your body loses water through breathing, sweating, and digestion, it's important to rehydrate by drinking fluids and eating foods that contain water.

What do you think we would see if we looked at that same portion of the sky with an even more powerful telescope that is in space?

Answers

Hhhyyyyyggvvvvvvbhhhhhyyyyyggggghgggggffcvvvfffffffhz gzmysmydyysudkdjdisrw and the dttyyuuuuiiiiuuuuu

hurry due in five min plz help

Answers

Answer:

b

Explanation:

Answer:

d

Explanation:

I hope that helped!

Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid

Answers

Answer:

Lipid is the most likely answer.

what is homeostasis?

the body's way of coping of outside factors

the body's ability to heat up and cool down

the body's natural way of maintaining equilibrium or balance

the body's standard heart rate​

Answers

The body’s natural way of maintaining equilibrium or balance

Answer: C or if there is an E for all the above

Explanation: Homeostasis refers to the body’s ability to maintain a stable internal environment (regulating hormones, body temp., water balance, etc.).

When you exhale, what happens in the lungs?
A. Air moves from high pressure (in the lungs) to low pressure (outside)
B. Space in the lungs increases
C. Lung pressure decreases
D. Air moves from low pressure (in the lungs) to high pressure (outside)

Answers

Answer:

Conversely, exhalation moves the diaphragm up into the chest cavity and reduces the space in it. This forces the air, which is dense with carbon dioxide at that point, out of the lungs and windpipe. It then exits the body either through the nose or mouth. Usually, this requires no physical effort from the body.

Explanation:

So its A

what is empty space that is free of matter

Answers

Outer space is an empty space that’s made up of gases, electromagnetic radiation, magnetic fields, neutrons and dust

2. Chemicals that absorb light
are called

Answers

Answer:

Chemicals that absorb light are called Pigments. 3. Chlorophyll makes plants look green because it Reflects green light.

Explanation:

Answer:

pigments

Explanation: Chlorophyll makes plants look green because it Reflects green light.

question one : when two plates converge, they are what?

a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other

question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other

question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age

Answers

Q1. They are d. colliding with each other.

Q2. They are c. sliding along each other (in a processes called “subduction”)

Q3. Rocks furthest away from the ridge are b. oldest the further away you move from the ridge. The youngest rocks can be found closest to the mid ocean ridge.

List some common adaptations in organisms

Answers

Some common adaptation in organisms would be:

Behavioral adaptation.
Biological adaptation.
Natural selection.

Different plant species require different amounts of direct sunlight in order to flower. A student designed an experiment to determine the length of exposure to direct sunlight necessary for a specific plant species to produce flowers. The student collected the data below.


0 hours, 0% with flowers


9 hours, 0% with flowers


1 hour, 0% with flowers


5 hours, 90% with flowers


3 hours, 80% with flowers


7 hours, 10% with flowers


Identify the:

independent variable-

dependent variable-

control group-

experimental group-

constant-

Answers

Answer:

Independent variable: LENGTH OF EXPOSURE TO DIRECT SUNLIGHT

Dependent variable: PRODUCTION OF FLOWERS

Control group: THE GROUP OF PLANT THAT WASN'T EXPOSED TO SUNLIGHT i.e. 0 hours

Experimental group: THE GROUP OF PLANTS THAT WERE EXPOSED TO SUNLIGHT

Constant: THE SAME PLANT SPECIES

Explanation:

Independent variable is the variable that the experimenter changes or manipulates in an experiment. In this experiment, the experimenter exposes the specific plant species to sunlight at different length of time, hence, the LENGTH OF EXPOSURE TO DIRECT SUNLIGHT is the independent variable.

Dependent variable is the variable which is measured in an experiment. In this experiment, the measured/dependent variable is the PRODUCTION RATE OF FLOWERS by the plant species.

Control group is the group in an experiment that does not receive the variable being tested. In this experience, the control group is THE GROUP OF PLANT THAT WASN'T EXPOSED TO SUNLIGHT i.e. 0 hours

Experimental group is the group of am experiment that is exposed to the experimental treatment (sunlight). In this case, the experimental group is THE GROUP OF PLANTS THAT WERE EXPOSED TO SUNLIGHT.

Constants are variables of an experiment that must be kept unchanged for all groups throughout the experiment in order not to affect the experiment's outcome. In this experiment, the constant is THE SAME PLANT SPECIES used,

Which of the following statements supports the need for a handler to know an animal’s point of balance? A handler must know an animal’s pattern of movement in order to avoid injury. A handler must know where to stand in order to avoid injury. A handler must know proper feeding procedures in order to avoid injury. A handler must not use a loud voice in order to avoid injury.

Answers

Answer:

A handler must know an animal’s pattern of movement in order to avoid injury.

Explanation:

Point of balance refers to equalibrium so if you know the animals pattern of movemenrt you are less likely to get injured while moving on or with it.

Answer:

A

Explanation:

i got it wrong and it showed the correct answer

What is typical of cell reproduction when cancer cells are reproduced in a petri dish from a tissue culture? Check all that apply.

Answers

Answer:

Cells reproduce without limit. Cells reproduce with multiple cells

Tissue culture I haven’t studied that tho,....lkkeodkekfkeofk

fill in the complementary bases according to the base-pair rule.

a | t | c | c | g | a | t | a | g | c | t | t | a | g

Answers

t/a/g/g/c/t/a/t/c/g/a/a/t/c

What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?

Answers

The proton gradient produced by proton pumping during the electron transport chain is used to synthesize ATP. Protons flow down their concentration gradient into the matrix through the membrane protein ATP synthase, causing it to spin (like a water wheel) and catalyze conversion of ADP to ATP.

Help please
I’m begging you, due in an hour

Answers

Answer:

1 should be D and 2 should be A

Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?

Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?

Answers

Answer:

Wedging (for the first one)

Explanation:

A water molecule is attracted to another water molecule. This is an example of

Answers

This is an example of cohesion. :)

Which is the process by which gas exchange between the respiratory system and the blood cells in the cappilaries occurs? transfusion condensation evaporation diffusion

Answers

Answer:

Diffusion

Explanation:

Diffusion is the process by which molecules of substances move from regions of higher concentration to regions of lower concentration until equilibrium concentration is attained. This movement of molecules is because a concentration gradient exists between the two regions.

Blood cells in the capillaries is low in oxygen because the cells have used up the oxygen in cellular respiration. However, in the lungs, the oxygen concentration is high due to inspiration of oxygen from the external environment. Therefore, a concentration gradient exists between the lungs and blood cells in the capillaries. Oxygen from the lungs diffuses into the blood cells in the capillaries, and these blood cells are then returned to other parts of the body by the circulatory system. This is a continuous process and is known as gaseous exchange.

Answer:

Diffusion

Explanation:

Please Help me as soon as possible.

In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.

Answers

Answer:

The answer is; c

It is important to distinguish between codominance and incomplete dominance.

In incomplete dominance, the two alleles blend with each other in phenotype  giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.

In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.

Explanation:

What is H₂O - H₂+ boz

Answers

Answer:

-tH2

H20 - H2 + boz

0-H2t

-tH2

What components are needed for
photosynthesis?

Answers

Answer:

sunlight, carbon dioxide, and water as substrates

Explanation:

Hope this helps :]

Answer:

Explanation:

chicken leg piece and/Photosynthesis is a multi-step process that requires sunlight, carbon dioxide, and water as substrates. It produces oxygen and glyceraldehyde-3-phosphate (G3P or GA3P), simple carbohydrate molecules that are high in energy and can subsequently be converted into glucose, sucrose, or other sugar molecules.

are bones living or non living and why

Answers

Answer:

i think they are non living

Explanation:

because they dont have organs or blood or anything

Answer:

Bones are non living

Explanation:

1: Bones don’t movement on their own

2: Bones don’t have cells

3: Bones do bot breathe

4: They do not count on anything to survive

5: They are just something that helps a living organism to move

Are Bacteria (essential/non-essential) to sustaining the EcoSphere?

Answers

Essential because not all bacteria are harmful and we need bacteria in our daily lives

what is the percentage of thymine in wheat ?

Answers

Answer:

27.1% or 27% if rounded

Explanation:

Hope this helps ya!!

Other Questions
Pina Corporation sells rock-climbing products and also operates an indoor climbing facility for climbing enthusiasts. During the last part of 2017, Pina had the following transactions related to notes payable. Sept. 1 Issued a $16,800 note to Pippen to purchase inventory. The 3-month note payable bears interest of 8% and is due December 1. (Pina uses a perpetual inventory system.) Sept. 30 Recorded accrued interest for the Pippen note. Oct. 1 Issued a $21,600, 9%, 4-month note to Prime Bank to finance the purchase of a new climbing wall for advanced climbers. The note is due February 1. Oct. 31 Recorded accrued interest for the Pippen note and the Prime Bank note. Nov. 1 Issued a $26,400 note and paid $8,800 cash to purchase a vehicle to transport clients to nearby climbing sites as part of a new series of climbing classes. This note bears interest of 7% and matures in 12 months. Nov. 30 Recorded accrued interest for the Pippen note, the Prime Bank note, and the vehicle note. Dec. 1 Paid principal and interest on the Pippen note. Dec. 31 Recorded accrued interest for the Prime Bank note and the vehicle note.Required:Prepare journal entries for the transactions noted above. which test would be given before a blood transfusion? what is the d/CE between ruminant and non ruminant animals someone please help!!!!! Ill mark you brainliest. Susan, Mariana y Emma cumplen aos el mismo da. Al momento de partir la torta a Valentina le toc 1/6 , a Camila 2/6 y a Emma 2/6 partes de la Solve for x: 4 over 5 x + 4 over 3 = 2x x = Write your answer as a fraction in simplest form. Use the "/" symbol for the fraction bar. (2 points) what is 8 divided by 8 with a multitude of 53 degree angles On the periodic table of elements, all the elements within group 14 have the same number of The legislative branch has a term limit of either 2 or... years HELP! will give brainliest!!! The United States released 5.877 billion metric tons of carbondioxide into the environment through the burning of fossil fuels in a recent year. If1 trillion pounds = 0.4536 billion metric tons, how many trillion pounds of carbondioxide did the United States release in that year? Can someone help me plz.. please help:) please help:) What two states do binary numbers represent?A) Coder and processor B) Input and outputC) On and off D) Right and left Last month, Curtis bought a new mountain bike for $250. In a store advertisement, the mountain bike is on sale for $210. What is the percent of the decrease in the value of the mountain bike? A ________ is an unsecured bond, and most of the bonds sold today in the United States are of this type.A) mortgage bondB) debentureC) senior bondD) bond indenture Describe the motion of particles in a substance as thermal energy is added During free fall which object would have a greater acceleration, an object with a mass of 240 kg or an object with a mass of 10 kg? Explain your answer. Which is not true about the upper paleolithic period? A. People made tools by chipping flint pebbles into blades and scrapers that had sharp edges. B. Humans and animal forms begin to be seen in artC. The period took place between 40,000 and 4,000 BCE D. In cave art, Artists used the cave's irregularities to create images PLS HELP! I WILL MARK FIRST GOOD ANSWER BRAINLIEST!!!!!ubkhhjkbjhIf you could live in any decade, which one would you choose and why? (1 paragraph) pls 1 paragraphWhat type of text structure is this? What is the standard deviation of this data? Round your answer to the nearest hundredth of a number?10, 12, 8, 2