Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer 1

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:


Related Questions

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

Please I beg someone to help me
Which most likely accounts for the increase in the number of male butterflies in the five years after the initial parasite problem?

Answers

Idk for sure but the first one seems like the best choice :)

NEED HELP ASAP!!!! Explain why the fact that invasive species did not co-evolve with the native species unbalances an ecosystem.

Answers

Answer: The invasive species unbalance an ecosystem because it takes over an ecosystem and does not let the other native species thrive while it takes over. There are many invasive species around the world even in your own town or state there is a type of fish suppose that is an invasive species to Michigan called a sea lamprey which kills fish native  to the great lakes and is taking over there are also zebra muscles if you need another example

BRAINLIEST PLZ

            Invasive species lack native species' population controls, such as predators, because they did not co-evolve with the other species in the ecosystem. As a result, the population of an invasive species may spread unchecked and eventually throw an ecosystem out of balance.

Unbalances in ecosystem :

                 A natural or human-caused disruption that throws off an ecosystem's natural balance is known as an ecological imbalance. Both natural and man-made disturbances have the potential to upset an ecosystem's delicate balance. A species' extinction or the introduction of a new species may cause an ecosystem to become ecologically unbalanced.

                 All the organisms and the physical setting they interact with make up an ecosystem. The nutrition cycles and energy flows connect these biotic and abiotic elements. Photosynthesis is how energy enters the system and is absorbed by plant tissue. Both internal and external influences influence ecosystems. External variables that do not directly affect an ecosystem, such as topography, parent material that creates the soil, and climate, control the ecosystem's general structure. For instance, decomposition, root competition, shade, disturbance, succession, and the kinds of species present all regulate internal variables. While the availability of these resources within the ecosystem is normally governed by internal factors, the resource inputs are often controlled by external activities. As a result, interior variables influence ecological processes as well as being influenced by them.

To learn more about ecosystem refer :

https://brainly.com/question/842527

#SPJ2

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

The plates include the lithosphere under the oceans true or false

Answers

Answer:

A tectonic plate (also called lithospheric plate) is a massive, irregularly shaped slab of solid rock, generally composed of both continental and oceanic lithosphere. So i think its True

Which one is the correct answer?? The lined squares in the Punnett square represent____.

Answers

They represent the parent's genotypes.

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

Which are different forms of the same gene?
A.genotypes
B.phenotypes
C.alleles
D.traits

Answers

Answer:

alleles

Explanation:

An allele is a variant form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a chromosome. Humans are called diploid organisms because they have two alleles at each genetic locus, with one allele inherited from each parent.

Answer:

C. alleles

Explanation:

edge 2021

What makes something a compound microscope

Answers

Answer:

A compound microscope is an upright microscope that uses two sets of lenses (a compound lens system) to obtain higher magnification than a stereo microscope. A compound microscope provides a two-dimensional image, while a stereo microscope provides a three-dimensional image.  

Explanation:

COMPOUND MICROSCOPES are so called because they are designed with a compound lens system. The objective lens provides the primary magnification which is compounded (multiplied) by the ocular lens (eyepiece). ... Eyepieces are commonly 10x resulting in total magnifications of 40x to 1000x (Objective x Eyepiece).

Why must an organism be able to adjust to changing environments?

Answers

Answer:

blabkkbkkbcqcwwcqwqwwq

Explanation:

All organisms need to adapt to their habitat to be able to survive. This means adapting to be able to survive the climatic conditions of the ecosystem, predators, and other species that compete for the same food and space.

Describe how energy flows through an energy pyramid? Write your answer in the space provided below.

Answers

Answer:

Depending on the food pyramid, on the side there may be something that says decomposers. These eat from all of the sections of the pyramid.

Energy flows from the bottom to the top, and then to the side with the decomposer.

Cells reproduce by splitting in half a process called cell division what do you cells need between divisions to make sure that they don’t get smaller and smaller

Answers

A cell must grow and the DNA must be copied so there is a full set of DNA to pass on to the daughter cells

According to the graph below, at which point is the plant preforming the most photosynthesis?

A. Point D.
B. Point B.
C. Point C.
D. Point A.

Answers

Answer: C

Explanation:

Point c would be the answer to your question

what are the inputs and outputs of the reaction

Answers

Answer:

The inputs are carbon dioxide from the air and the ATP and NADPH produced by the light reactions. The cycle's output is an energy-rich sugar molecule. The Calvin cycle uses carbon from the carbon dioxide, energy from the ATP, and high-energy electrons and hydrogen ions from the NADPH.

Explanation:

The light reactions, which occur during photosynthesis, have specific inputs and outputs. The inputs of the light reactions include light energy and water. The outputs of the light reactions are ATP (adenosine triphosphate), NADPH (nicotinamide adenine dinucleotide phosphate), and molecular oxygen.

Light energy is absorbed by the chlorophyll pigments in the thylakoid membranes, while water molecules serve as a source of electrons for the photosynthetic electron transport chain.

ATP is a high-energy molecule that serves as the primary energy source for cellular processes. NADPH is a coenzyme that carries energized electrons and plays a role in the synthesis of carbohydrates during the subsequent dark reactions of photosynthesis. Molecular oxygen is a byproduct of light reactions and is released into the atmosphere as a waste product. Together, these outputs provide the energy and reduce the power needed for the synthesis of organic molecules during photosynthesis.

Therefore, the inputs of the light reactions include light energy and water. The outputs of the light reactions are ATP (adenosine triphosphate), NADPH (nicotinamide adenine dinucleotide phosphate), and molecular oxygen.

For more details regarding light reactions, visit:

https://brainly.com/question/13349357

#SPJ6

what was the problem with reusing contaminated water from other parts of the mill to extinguish the coke fires? From the book ‘When smoke ran like water’

Answers

Answer:

1. The problem with that was that the already poisonous water was made worse after using it to quench the flames from coke production.

2. It contaminated the soil, making it difficult for plants to grow.

Explanation:

As the author described the last stages of coke production, she explained that water was needed to quench the very hot flames from coke production. A 'bright fellow' suggested using dirty water from other parts of the mill to quench the flames from the coke production. The problems with this were;

1. The already contaminated water was made worse after it was used to quench the flames from coke.

2. Mrs. LaMendola noted that she was unable to grow her tomatoes in the path where the plumes from the oven ran. So the contaminated water negatively affected the soil.

The problem that should be already poisonous water is also made worse when it quenches the flames at the time when the production of the coke should be done.

Also, it contaminated the soil also it is difficult for growing the plants.

The problem of reusing contaminated water:

Since the author explained the last coke production stage so here the water required to quench that it should be very hot flames arise from the coke production. Also, the contaminated water should be worse whenever it is used for quenching the flames. Also, the contaminated water does not positively impact the soil.

Learn more about water here: https://brainly.com/question/18850280

struggling in bio h e l p

Answers

Answer:

d maybe but im still figuring it  out

Explanation:

Answer:

D

Explanation:

What is a natural source of CO2

Answers

Answer:

venting volcanoes

Explanation:

what is this pls help these are finals

Answers

Answer:

wowzerrrrrrs

Explanation:

What happens if oranisms fall to adjust and respond to changes in their environment?

Answers

Answer:

they would probably go extinct

Explanation:

I’m assuming the whole environmental system would collapse animals would die off including humans

Which American Indian group was allied with the British as the French and Indian War began?
A)the Huron
B)the Ottawa
C)the Iroquois Confederacy
D)the Algonquin

Answers

Answer:

The Iroquois Confederacy would be your answer.

hope it helps!

PLZ HELP ASAP WILL GIVE BRAINLIST!

Pick all the differences between prokaryotic (bacteria) and eukaryotic (animals,
plants, fungi) cells.

Prokaryotic cells do NOT have membrane bound organelles.

Eukaryotic cells do NOT have membrane bound organelles.

Prokaryotic cells do NOT have a nucleus.

Eukaryotic cells do NOT have a nucleus.

Answers

Answer:

Prokaryotes are organisms that consist of a single prokaryotic cell. Eukaryotic cells are found in plants, animals, fungi, and protists. They range from 10–100 μm in diameter, and their DNA is contained within a membrane-bound nucleus. Eukaryotes are organisms containing eukaryotic cells.

Explanation:

Answer: B

Explanation:


Which two cell types in placozoans make up the endoderm tissue layer?

A)cover cells and cylinder cells
B)gland cells and cover cells
C)fiber cells and cover cells
D)gland cells and cylinder cells

Answers

Answer:

D

Explanation:

I made a 100 on the text

Two cell types in placozoans make up the endoderm tissue layer are - D) gland cells and cylinder cells.

The Placozoa a marine free-living multicellular basal form of organism. These are condisered as the simplest structure of all animals.

It has three genera namely Trichoplax adhaerens, Hoilungia hongkongensis, and Polyplacotoma mediterranea.It has three tissue layers that are ectoderm, endoderm and mesoderm.The ectoderm are formed of cover cells.The bottom layer is made up of cylinder cells that has cilia used in locomotion, and gland cells that lack cilia.

Thus, two cell types in placozoans make up the endoderm tissue layer are - D) gland cells and cylinder cells.

Learn more:

https://brainly.com/question/4580106

Outputs of photosynthesis

Answers

Answer: carbon dioxide, water molecules, glucose, and oxygen

Explanation: Energy is used to convert carbon dioxide into oxygen and glucose.

Paragraph about Photosynthesis

Answers

Answer:

Photosynthesis is the process of making food by green plants in the presence of sunlight.

Explanation:

During Day, sunlight enters through stomata and carbon dioxide from air and water forms glucose and oxygen. This process is photosynthesis.

Who is the inventor of the modern classification system?

Answers

Answer:

Carolus Linnaeus

Explanation:

Answer:

Carolus Linnaeus

Explanation:

Who were the representatives
sent to work on the deal?

Answers

Answer:

Peace Negotiations

After Yorktown, the Continental Congress appointed a small group of statesmen to travel to Europe and negotiate a peace treaty with the British: John Adams, Benjamin Franklin, John Jay, Thomas Jefferson and Henry Laurens.

Which process is best illustrated by the diagram?

Answers

Answer:

Photosynthesis

Explanation:

The formula shown is the one for photosynthesis.  6CO2 + 6H2O → C6H12O6 + 6O2. (please tell me if i am correct) :)

which of the following cells shows the process of a nucleus? a. prokaryotic b. eukaryotic c. both

Answers

Answer:

b. eukaryotic

Explanation:

"Eukaryotic" means to have a nucleus.
eukaryotic because the other one lacks a nucleus

ASAP?!!!!!!!!!!!!
IMAGE IS ATTACHED

What is the genotype ratio for this cross?
What is the phenotype ratio for this cross?

Answers

Answer:

If I'm not mistaken, the genotype ratio should be 1:2:1 and the phenotype ratio should be 3:1

Explanation:

Genotypic Ratios and Phenotypic Ratios for Punnett Squares on Y*uT*be

how would you classify the bloody fingerprint found in the pedro ramon velasquez case?
patent
latent
delta
plastic

Answers

Answer:

patent

Explanation:

Other Questions
How to we measure energy? What did citizens of Athens value most? 18)Whiskey, gin, and vodka are examples ofspirits (3 pts). First, read the dictionary definition. Then, complete the task.Dictionary Definition: criticize someone with harmful intent Do turkeys get sleepy from that thing in turkey that makes you sleepy? Submit the following two items:evidence of your research on a Dr. Seuss book, which includes: title, author (Seuss), publisher, a list of his invented words that you like, and commentary on what you felt was the funniest stanza in the bookyour own short, funny story that uses your own invented words for as many things as possible in the story The cost of 4 belts and 5 ties is $247. Each time costs 3 times as much as a belt. What us the total cost of 1 belt and 1 tie What is required to view other users calendars in Schedule view? Check all that apply.their e-mail addressestrue Exchange Environmenttheir Outlook passwordan e-mailed version of their calendarprivileges to share and view calendars The war of the United States with Spain was very brief. Its results were many, startling, and world-wide meaning. -Henry Cabot Lodge, The War with Spain, 1899Which of the following made the Spanish-American war of 1898 a significant event of world-wide meaning?A.The rise to power of the Communist party in key Latin American nationsB.The naval and military victories that showed the United States as an emerging world powerC.The startling economic downturn that immediately followed the warD.The rise of isolationist sentiment within the United States population a flask of 0.30 L was weighted after it had been evacuated.It was then filled with a gas of unknown molecular mass at 760 mm of Hg and temperature of 300 K. The increase in mass of flask was found to be 0.997 g. Determine the molecular mass explain how to separate sugar from supersaturated sugar solutionguys pls help Below are the test scores of nine students on the math test:50, 50, 50, 50, 51, 89, 90, 90, 90What is the mean absolute deviation of the test scores? (round to the nearest thousandth) Read the excerpt from The Narrative of the Life of Frederick Douglass.Our confidence in each other was unshaken. We were resolved to succeed or fail together, after the calamity had befallen us as much as before. We were now prepared for any thing. We were to be dragged that morning fifteen miles behind horses, and then to be placed in the Easton jail. When we reached St. Michael's, we underwent a sort of examination. We all denied that we ever intended to run away. We did this more to bring out the evidence against us, than from any hope of getting clear of being sold; for, as I have said, we were ready for that. The fact was, we cared but little where we went, so we went together. Our greatest concern was about separation. We dreaded that more than any thing this side of death.Based on the excerpt, which best describes Douglasss point of view?Douglasss fear of danger kept him from achieving goals.Douglasss greatest concern was his personal safety.Douglasss confidence in his relationships was weak.Douglasss relationships were of the highest importance to him. simplify the expression2x/(x+4) + 8/(x+4) Who was George WhiteField Discount and Tax examples for math... HELP!!!! d. Prepare immediate and long term ways to abolish the social problem and evils in our societies. determine whether the triangles are congruent by sss sas asa aas or hl Solve.4x -6= 14X=? What is one benefit of consumer-protection regulations?