Combine the like terms to create an equivalent expression:
-k+3k

Answers

Answer 1

Answer:2k

Step-by-step explanation:

-k+3k

-1k+3k

(-1+3)k

2k

Answer 2

Answer:

2k

Step-by-step explanation:

-k is the same as -1k so you can just solve it like that. Also, when adding terms with variables you just add the number in front (if they have the same variable). So -1k + 3k = 2k. Pretty much the same as -1 + 3, you just add a variable..


Related Questions

what is the modulus of the complex number -4+3i

Answers

The modulus of the complex number -4+3i is 5.

Complex number is an element of a number system that contains the real numbers and a specific element denoted i, called the imaginary unit,

A complex number is a number of the form a + bi, where a and b are real numbers.

The modulus (z) of a complex number x + iy is given by:

z = √(x² + y²)

The modulus of the complex number -4+3i is:

[tex]z=\sqrt{(-4)^2+3^2} =\sqrt{25}=5[/tex]

Find out more on complex number at: https://brainly.com/question/2218826

Lilly buys fresh fruit from a fruit stand. Apples cost $5 per pound and oranges cost $4 per pound. She has $40 to spend. The table shows the function relating the number of pounds of apples, x, and the number of pounds of oranges, y, Lilly could purchase.

Apples (lb) Peaches (lb)
x y
0 10
1 8.75
2 7.5
4 5
6 2.5
8 0

Answers

Answer:

Different ways to answer this question

Step-by-step explanation:

You can do a ratio  of 1:4 apples and 1:5 oranges

-4x+ lly = 15

pls help me

x=2y​

Answers

Answer:

y = 5

Step-by-step explanation:

-4(2y) +11y = 15

-8y + 11y = 15

3y = 15

y = 5

What is the equation for the line perpendicular to y=3/2x + 2 that contains (3, -5)?

Answers

Answer:

B?

COREEC IF WRONG

Answer:

y=-2/3x-3

Step-by-step explanation:

let the slope of the given line =m1

let the slope of the perpendicular line,=m2

m2=-1/m1

m2=-1/3/2

m2=-2/3

Now the equation of the perpendicular line

y--5=-2/3(x-3)

y+5=-2/3(x-3)

3y+15=-2x+6

3y=-2x+6-15

3y=-2x-9

y=-2/3x-3

Which line plot (s) represents 2/4?

Answers

Answer:

Number 1= 5th vertical line

number 2= 2nd vertical line

number 3= halfway between 2nd and 3rd vertical line

Step-by-step explanation:

what is 65% more of 140

Answers

65% more than 140 is  231

PLS HELP ME I WILL GIVE BRAINLESS] Solve the problems. AA + 5 JoJo Seaweed walks at a constant rate d. able shows the relationship of feet to seconds. What is the constant of proportioiyality for the relationship of feet to minutes? Record your answer on the grd. Then fill in the bubbles. Feet 8 80 160 Seconds 2. 20 40 |​

Answers

Answer:

I think that if u times it i will be 80 s and 320 f

Step-by-step explanation:

In order to make a specific shade of green paint, a painter mixes 1/2
of a gallon of blue paint with 4/5
of a gallon of yellow paint.

How many gallons of each color are needed to make 26 total gallons of this color?

Answers

10 gallons of blue paint was mixed with 16 gallons of yellow paint to make 26 total gallons.

Let x represent the total amount of paint.

(1/2)x + (4/5)x = 26

1.3x = 26

x = 20

Therefore:

Amount of blue paint = (1/2)x = (1/2)*20 = 10 gallons

Amount of yellow paint = (4/5)x = (4/5)*20 = 16 gallons

10 gallons of blue paint was mixed with 16 gallons of yellow paint to make 26 total gallons.

Find out more on equation at: https://brainly.com/question/2972832

True or False. If true, give a convincing argument. If false, explain why it is false. Be sure to use mathematical language in your explanation.

As an airplane flies toward you, its angle of elevation increases.

Answers

Answer:

True.

Step-by-step explanation:

We assume that the plane is flying at a constant height above the ground.

The angle of elevation is the angle made between the plane, you and the point on  the ground directly below the plane. As the plane approaches you the distance between you and the point on the ground decreases and therefore the angle of elevation increases.

Chuy wants to buy a new television. The television costs $1,350. Chuy decides to save the same amount of money each week, for 27 weeks. After 8 weeks Chuy saved $440. Which of the following conclusions can you make about Chuy's plan? a. Chuy has a good plan and will have exactly $1,350 saved at the end of 27 weeks. b. Chuy must increase the amount he saves each week in order to meet his goal at the end of 27 weeks. c. Chuy will save more than he needs and will meet his goal in less than 27 weeks. d. There is not enough information given to make a conclusion about Chuy's plan. Please select the best answer from the choices provided A B C D

Answers

Answer: C: Chuy will save more than he needs and will meet his goal at the end of 27 weeks.

Step-by-step explanation: Divide the amount of money saved, $440, by the number of weeks, 8.

440/8 = $55.

This means $55 is the amount of money Chuy saves every week.

Multiply $55 by the number of weeks Chuy plans to save money, 27.

55 x 27 = 1,485.

Since the television costs $1,350 dollars, Chuy will save more than he needs and will meet his goal in less than 27 weeks.

Plz help with this question.If can't do it don't answer.

Answers

Answer:

the total surface area of this triangular prism is 976cm2

Answer:

i think TSA = 976 cm²

Step-by-step explanation:

TSA = 2(1/2×14×24) + (14+25+25)×10

TSA = 2(7×24)+(64×10)

TSA = 336+640

TSA = 976 cm²

Use the linear combination method to solve the system of equations. â€""3x 8y = 16 3x 4y = 8 What is the value of x? â€""1 0 1 2.

Answers

The value of x from the system of equation is 0

Given the systems of equation

–3x + 8y = 16

3x + 4y = 8

Using the elimination method.

Add both equations

-3x + 3x + 8y + 4y = 16 + 8

12y = 24

y = 24/12

y = 2

Substitute y = 2 into equation 2:

3x + 4y = 8

3x + 4(2) = 8

3x = 8 - 8

3x = 0

x = 0

Hence the value of x from the system of equation is 0.

Learn more on simultaneous equations here:https://brainly.com/question/185757

I have a system of equations I don’t remember how to do :|

I forgot how to solve this, and I forgot how to find the slope…

Answers

Answer:

  x + y = 3 (infinite solutions)

Step-by-step explanation:

You observe that all of the numbers in the second equation are multiples of 3. When you divide the second equation by 3, it becomes identical to the first equation. The equations are said to be "dependent."

That means both equations graph as the same line, so will intersect at every point on the line. The system of equations has an infinite number of solutions.

_____

Additional comments

There are a number of ways to solve a system of equations. Two methods commonly taught are "substitution" and "elimination". Either one works here.

We can solve the first equation for y by subtracting x from both sides:

  x +y -x = 3 -x

  y = -x +3 . . . . . . simplify

In this form, the slope is the coefficient of x. Here, it is -1.

This expression for y can be substituted into the other equation:

  3x +3(-x +3) = 9

  3x -3x +9 = 9 . . . . . eliminate parentheses

  9 = 9 . . . . . . . . . . . simplify

This is true for all values of x or y. There are an infinite number of solutions.

Answer:

There are infinite numbers of solution.

Step-by-step explanation:

Question :

[tex]\begin{gathered}\begin{gathered}\begin{gathered}\small\begin{cases}\sf{x + y= \bf{3}} \\ \\ \sf{3x + 3y= \bf{9}}\end{cases} \end{gathered}\end{gathered}\end{gathered}[/tex]

Solution :

Solving the question and finding the final answer.

Here,

x + y = 3 . . . (i)3x + 3y = 9 . . . (ii)━━━━━━━━━

Now, from equation (i),

[tex]\twoheadrightarrow{\sf{x + y = 3}} [/tex]

[tex]\twoheadrightarrow{\sf{x = 3 - y}} [/tex]

━━━━━━━━━

Now, putting the value of x in equation (ii)

[tex]\begin{gathered} \qquad{\longrightarrow{\sf{3x + 3y = 9}}} \\ \\ \qquad{\longrightarrow{\sf{3(3 - y) + 3y = 9}}} \\ \\ \qquad{\longrightarrow{\sf{9 - 3y + 3y = 9}}} \\ \\ \qquad{\longrightarrow{\sf{9 - 0 = 9}}} \\ \\ \qquad{\longrightarrow{\sf{9 - 0 = 9}}} \\ \\ \qquad{\longrightarrow{\sf{\underline{\underline{\red{9 = 9}}}}}}\end{gathered}[/tex]

This statement is true for all values of x and y.

So, there are infinite numbers of solution.

[tex]\underline{\rule{220pt}{3pt}}[/tex]

Find the circumference of a circle with a radius of 11.15 cm

Answers

Answer:

390.377

Step-by-step explanation:

pi*r^2

which is a better deal? 5 pens for $1.85 OR 8 pens for $3.12 ? find the unit rate

Answers

Answer:

5 pens

Step-by-step explanation:

1.85 divided by 5 is .37

3.12 divided by 8 is .39

so 1.85 is a better deal

Find the area of each figure

Answers

30yd^2
Explanation-
B•h/2
10•6=60
60/2=30
:)

Graph the linear equation 3x - 4y = 12 ​

Answers

In this picture there is answer

what is the solution
3x-1/4 = -5/11
(3x-1)11 = -5(4)
33x-11 = -20
+11 = +11
33x = - 9
33x/33 = -9/33
x = -3/11

Answers

Answer:

3x-1/4=-5/1111 (3x-1)=4 (5)33x-11=2033x=20+1133x=31x=31/33x=?

Which of these is a correct statement regarding payday loans

Answers

Step-by-step explanation:

I think your question is not complete

resend it if you don't mind

They're easier to get than both mortgages and car loans

Question 3 of 5
764 =
O A. 16
OB. 4
O c. 2
O D. 8

Answers

Answer:

b. 4

Step-by-step explanation:

I hope this helps!!

The answer is B equal to four

read what on the image and it is so easy

Answers

F - 1.47

The largest box represents 100 small cubes or 1. The four pillars represent 10 and there is four of them so it is 40. Then, the individual cubes are 7. So, 1.47.

there are five bells which ring at interval of 4,5,12 and 15 minutes respectively at what minute those bells ring at the same time?​

Answers

Answer:   60 minutes

=====================================================

Explanation:

Let's find the LCM of 4 and 5, which are the first two items of the list.

multiples of 4 are: 4,8,12,16,20,24,...multiples of 5 are: 5,10,15,20,25,...

The smallest item in each list is 20, so the LCM of 4 and 5 is 20.

We can replace the "4,5" in the list "4,5,12,15" with "20". So our new list would be "20,12,15".

We then repeat the process of finding the LCM of the first two items

multiples of 20 are: 20,40,60,80,...multiples of 12 are: 12,24,36,48,60,72,...

LCM of 20 and 12 is 60.

The list "20,12,15" condenses to "60,15".

Repeat this process of finding the LCM once more and you'll find the overall LCM is 60.

Therefore, the LCM of the entire set {4,5,12,15} is 60. This is the smallest multiple shared by all four values. Interestingly enough, the outer values pair up to multiply to 60, and so do the inner values.

4*15 = 60

5*12 = 60

The bells ring together every 60 minutes

In other words, all of the bells ring together at the same time every hour (perhaps at the top of every hour; eg at 7:00 pm and at 8:00 pm, etc).

Determine the intercepts of the line.

Answers

Answer:

y-intercept: (0,5)

x-intercept: (5/2,0)

Step-by-step explanation:

[tex]-4x+7=2y-3[/tex]

[tex]-4(0)+7=2y-3[/tex]

[tex]0+7=2y-3[/tex]

[tex]7=2y-3[/tex]

[tex]10=2y[/tex]

[tex]5=y[/tex] <-- y-intercept: (0,5)

[tex]-4x+7=2y-3[/tex]

[tex]-4x+7=2(0)-3[/tex]

[tex]-4x+7=-3[/tex]

[tex]-4x=-10[/tex]

[tex]x=\frac{5}{2}[/tex] <-- x-intercept: (5/2,0)

2/7x9 in simplest form

Answers

Answer:

2/63

Step-by-step explanation:

I'm going to assume that the x is a multiplication symbol.

7 x 9 = 63

Therefore, the simplest form would be 2/63

HELP ASAPPPPPPP!!!!!

Answers

you will do 7x2x2x3 then after u find the answer you will write it in a fraction form like for example if you get 64 which is the answer and u will write 6 over 4 and that is the answer.

The graph of a line passes through the points (0, 8) and (4, 0). What is the equation of the line?

Answers

Answer: y = -2x + 8

Step-by-step explanation:

gradient = change in y/ change in x = 8/-4 = -2

y = -2x + c

substitute values in

8 = 0 + c

c = 8

y = -2x + 8

The graph of a line passes through the points (0, 8) and (4, 0), the equation of the line is y = -2x + 8

How to find the equation of a line

The line is the distance between two points. The equation of a line in slope-intercept form is y = mx + b

m is the slopeb is the y-intercept

Find the slope

Slope = -8/4
Slope = -2

Determine the y-intercept

Since the y-intercept is the point where the line cross the y-axis, hence b = 8.

FInd the required equation

y = -2x + 8

Hence if the graph of a line passes through the points (0, 8) and (4, 0), the equation of the line is y = -2x + 8

Learn more on equation of a line here: https://brainly.com/question/18831322

The water level in a tank measures 15 inches and is decreasing 0.5 inches every
minute.
How many minutes, x, will it take for the water level to measure 9 inches deep?

Answers

Answer:

The answer is 12 minutes

Step-by-step explanation:

This is because if you're seeing how long it takes to get from 15 inches to 9 inches, that is a difference of 6 inches.

6 / 0.5 inches per minute = 12 minutes

The tank would take time of 12 minutes for the water level to measure 9 inches deep.

What is the two-step problem?

A two-step problem is a word problem that must be addressed in two steps. While many of these questions have only one step, a two-step word problem requires the solution of two separate equations.

Two separate operations (like multiplication and addition) or two of the same operation may be utilized in the two-step word problem (like subtraction and subtraction).

Given a tank measurement of 15 inches, it shrinks by 0.5 inches per minute.

We must calculate the minute when the water level reaches 9 inches deep.

The difference in inches is 6 inches.

15 inches - 6 inches = 9 inches

Calculating for minutes,

⇒ 6 / 0.5

⇒ 12 minute

Therefore, the tank would take time of 12 minutes for the water level to measure 9 inches deep.

To learn more about the two-step problem click here :

brainly.com/question/26119747

#SPJ5

Please help me with this problem!

Answers

Answer:

57 degrees

Step-by-step explanation:

It is an isosceles triangle because QP has the same length as OP. So the base angles will be the same.

What is the value of x?

Answers

[tex]\large\huge\green{\sf{Answer:-}}[/tex]

option d is correct

[tex]\large\huge\green{\sf{Explanation:-}}[/tex]

The sum of all three angle of triangle is180°

[tex](8x + 5) + (5x - 1) + (4x + 6) = 180 {}^{o} \\8x + 5 + 5x - 1 + 4x + 6 = 180 {}^{o} \\ 8x + 5x + 4x + 5 - 1 + 6 = 180 {}^{o} \\ 17x + 10 = 180 {}^{ {}^{o} } \\ 17x = 180 - 10 \\ 17x = 170 \\ x = \frac{170}{10} = 17 \\ x = 17[/tex]


Order the angles in the triangle above from largest to smallest.
Largest
1.B
2.D
3.С
Smallest

Answers

The order is C, B, then D.
Other Questions
EASY 9TH GRADE MATHWrite an equation in point-slope form that passes through the point (1,-10) andis perpendicular to y = -1/3 x + 5.Do NOT type spaces between numbers and symbols.TilALE11SE What does this chart reveal about education in South Africa? How do you think this will affect the economy? If (6^2]^p = 6^10, what is the value of p? A.) 2 B.) 3C.) 4D.) 5 has anyone done this and if u have please help me !! :(( How many moles does 205 g of helium,He, contain ? which best explains the impact of european colonization on the inca and aztec civilizations? When is it best to solve a system of equations using substitution? As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg)