Can someone help me with all of this? Cause I think I’m messing up. Can someone please correct me? Will give brainliest and heart!

Can Someone Help Me With All Of This? Cause I Think Im Messing Up. Can Someone Please Correct Me? Will

Answers

Answer 1

Answer:

material is also known as traits

is responsible for (also) traits

such as skin color and eye color

Explanation:

i'm just doing this to help. no need for the brainliest thingy.


Related Questions

Christopher Columbus used the presence of suspended seaweed in the ocean to
determine how far away he was from the coast of the Africa. Seaweed, or kelp, is
placed under the Protista kingătom. What type of protist did Columbus see?
a)protozoa
b) slime mold
c) water mold
d) brown algae

Answers

Your answer is d he saw brown algae

Brown algae is the type of protist Columbus saw. Therefore, option (D) is correct.

What are brown algae?

Seaweed is a type of brown algae, which is a type of protist that belongs to the kingdom Protista. Brown algae are large, multicellular algae that grow in the ocean and are often found in shallow, warm waters. They have a complex structure and are made up of many cells that are organized into tissues and organs. Brown algae are photosynthetic, meaning they use sunlight to produce energy and nutrients, and they are an important source of food and habitat for many marine organisms.

Other types of protists include protozoa, which are single-celled, heterotrophic organisms that can move using cilia, flagella, or pseudopodia; slime molds, which are fungi-like organisms that can move and are often found in moist environments; and water molds, which are fungi-like organisms that can grow in water and can cause disease in plants and animals.

Learn more about brown algae, here:

https://brainly.com/question/8717436

#SPJ2

100 ponits!!!
Mafic rocks are...
a.high in silica content
b.low in Fe & Mg content
c.high in Fe & Mg content
d.low in silica content

Answers

Answer:

B

Explanation:

YOOOOOOOOOOOOOOOOOOOOOO

ELETSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?

Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?

Answers

Answer:

Wedging (for the first one)

Explanation:

Explain how one celled organisms get oxygen in water.

Answers

Answer:

n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.

Explanation:

hurry due in five min plz help

Answers

Answer:

b

Explanation:

Answer:

d

Explanation:

I hope that helped!

Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid

Answers

Answer:

Lipid is the most likely answer.

fill in the complementary bases according to the base-pair rule.

a | t | c | c | g | a | t | a | g | c | t | t | a | g

Answers

t/a/g/g/c/t/a/t/c/g/a/a/t/c

What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?

Answers

The proton gradient produced by proton pumping during the electron transport chain is used to synthesize ATP. Protons flow down their concentration gradient into the matrix through the membrane protein ATP synthase, causing it to spin (like a water wheel) and catalyze conversion of ADP to ATP.

A substance only composed of one kind of atom is a(n) *

Answers

Element is your answer

Explanation it is on the periodic table

Transcription: DNA to mRNA: 1. How many strands of mRNA are transcribed from the two "unzipped" strands of DNA? 2. If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA code onto mRNA? G-G-A-T-C-G-C-C-T-T-A-G-A-A-T-C 3. If DNA Is described as a double helix, how should mRNA be described? 4. How are the accuracy of DNA and mRNA codes assured?
( help please)​

Answers

Answer:

what are u taking this on

Using the diagram below, how many electrons will Be have if it is a neutral atom?

Answers

the answer is six electrons

what is the percentage of thymine in wheat ?

Answers

Answer:

27.1% or 27% if rounded

Explanation:

Hope this helps ya!!

Please Help me as soon as possible.

In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.

Answers

Answer:

The answer is; c

It is important to distinguish between codominance and incomplete dominance.

In incomplete dominance, the two alleles blend with each other in phenotype  giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.

In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.

Explanation:

What do you think we would see if we looked at that same portion of the sky with an even more powerful telescope that is in space?

Answers

Hhhyyyyyggvvvvvvbhhhhhyyyyyggggghgggggffcvvvfffffffhz gzmysmydyysudkdjdisrw and the dttyyuuuuiiiiuuuuu

4) How does climate affect ecosystems and the life within them?

Answers

Answer:

Explanation:Climate is an important environmental influence on ecosystems. Changing climate affects ecosystems in a variety of ways. For instance, warming may force species to migrate to higher latitudes or higher elevations where temperatures are more conducive to their survival.

The law of___________explains how traits are inherited through generations.

Answers

Answer:

the law of inheritance

........ produces hormones and enzymes that aid digestion.

Liver

Gall bladder

Pancreas

Urethra​

Answers

Answer:

urethra

Explanation:

Answer:

Pancreas and liver

Explanation:

ASAPPPP!!!!
Write step by step instructions for making a protein

Answers

Protein synthesis is the process in which cells make proteins. It occurs in two stages: transcription and translation. Transcription is the transfer of genetic instructions in DNA to mRNA in the nucleus. It includes three steps: initiation, elongation, and termination.

Which name is best for my new bearded dragon?
1. Chili
2. Mushu (dragon from Mulan)
3. Blue (dino from Jurassic Park)

Answers

Mushu is a definitely answer

Answer:

Mushu

Explanation:

What is typical of cell reproduction when cancer cells are reproduced in a petri dish from a tissue culture? Check all that apply.

Answers

Answer:

Cells reproduce without limit. Cells reproduce with multiple cells

Tissue culture I haven’t studied that tho,....lkkeodkekfkeofk

SOMEONE I NEED HELP!! I'M STUCK 30 POINTS!!!!!
PART A
An advantage of mitosis is the result of genetically____________.
A. Different
B.Identical

PART B
cells being reproduced
A. slowly
B. Quickly

Answers

I think A for part 1 and B for part 2 but not sure
Part A : Mitosis creates identical copies of the original cells.

Part B : That question is worded weirdly so I don’t understand that.

Which of the following is a pluton?
A. Pyroclast
O
B. D*ke (it's a type of rock not the slur)
O
C. Lahar
O
D. Lava flow​

Answers

Answer:

The correct answer is d*ke

Explanation:

I tried the other answer and got it wrong, this was the right one on the test.

If you were to leave a pan of water outside for several days what would happen
Write a scientific report on the what would happen, and how would they relate to the tree states of water: solid, liquid and gas.

At least 3 paragraphs.​

Answers

Answer:

the water would evaporate and the water would be gone

Explanation:

hope this helps

Give two examples each of centripetal force​

Answers

Answer:

Spinning a ball on a string or twirling a lasso: Here the centripetal force is provided by the force of tension on the rope pulls the object in toward the centre. Turning a car: Here the centripetal force is provided by the frictional force between the ground and the wheels.

Explanation:

A h e t e r o z y g o u s parent is crossed with a h o m o z y g o u s recessive parent. Complete a Punnett Square and answer the questions below.

Answers

I Am Not Sure What Your Asking?

Answer:

Black Fur & Black Eyes: 4/16

Black Fur & Red Eyes: 4/16

White Fur & Black Eyes: 4/16

White Fur & Red Eyes: 4/16

4 is 1/4 of 16

Explanation:

I hope this helps

WILL GIVE BRAINLIEST!!!!!!
An amino acid is to a polypeptide as:

glycogen is to glucose.

testosterone is to a steroid hormone.

a phospholipid is to a plasma membrane.

a nucleotide is to a nucleic acid.

Answers

Answer would be D!
Mark brainliest

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

question one : when two plates converge, they are what?

a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other

question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other

question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age

Answers

Q1. They are d. colliding with each other.

Q2. They are c. sliding along each other (in a processes called “subduction”)

Q3. Rocks furthest away from the ridge are b. oldest the further away you move from the ridge. The youngest rocks can be found closest to the mid ocean ridge.


What would be the temperature at a depth of 2500 km?


Answers

Answer:

4700 Degrees Celsius

Explanation:

In eukaryotes the electron transport chain is composed of a series of electron carriers located in the blank of mitochondrion

Answers

Answer:

Facts that is right

Explanation:

In eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

The electron transport chain is composed of four large, multiprotein complexes. These protein complexes are formed of a series of electron carriers.

These complexes are embedded in the inner mitochondrial membrane and two small diffusible electron carriers shuttling electrons between them.These transfer electrons from electron donors to electron acceptors via redox reactions and joins this electron transfer with the transfer of protons across a membrane.

Thus, in eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

Learn more about:

https://brainly.com/question/7135096

Other Questions
Two unrelated American quarter horses are bred together. What is this an example of? 11. In Peppermint Patty's letter home to her grandmother, what does sheclaim the founding fathers are debating about behind closed doors? Gravitational potential energy is potential energy based on what?a. temperatureb.heightc. lengthd. volume . David drives 40 miles in one hour. How many miles does he drive in 1.5 hours? Paul opened a bakery. The net value of the bakery(in thousands of dollars) t months after its creation ismodeled byv(t) = 2412t - 14Paul wants to know what his bakery's lowest netvalue will beRewrite the function in a different form(factored or vertex) where the answer appearsas a number in the equation. The ratio of women to men at a college is 9 to 8. If there are 5,644 students in the school, how many more women are there than men?A) 332B) 2988C) 2656D) 705 El plomo y el yodo forman dos compuestos. En uno, el porcentaje de en masa de plomo es del 44,94% y en el otro es de 62,02%. Calcula los gramos de plomo por gramos de yodo en cada compuesto The equation of the graphed line is x+2y=5. What is the x-intercept of the graph? The equation y = 5.5x represents a proportional relationship. What is the constant of proportionality? Find A. Round to the nearest tenth: when your mom is spanking you what should you do? A.put her in a lock B.call her parents C.tell jamall to calm down D.take the hits In a survey of 3,500 people who owned a certain type of car, 1,925 said they would buy that type of car again. What percent of the people surveyed were satisfied with the car?I need this by tonight so please help! given the equation 9x+3Y=7 which equation is perpendicular to an equation with a y intercept of 12 Oak Street intersects with Mill Avenue. The traffic light on Oak Street follows a cycle. It is green for 35 seconds, yellow for 5 seconds, and red for 20 seconds. As you travel along Oak and approach the intersection, what is the probability that the first color you see is red? Write the probability as a simplified fraction. Incorrect feedback has been removed from the screen. Fill in the blank text field 1 George runs a mid-size accounting practice and recently upgraded to Excel 2016. He expects sales to grow in the next few months during tax season. After that, he would like to begin upgrading some of the equipment and furniture for the employees in his office. He will start with the Reception area, which has the most visibility. If sales reach a certain amount by the end of April, George will purchase a desk, chair, computer, and software upgrade for the receptionist. Otherwise, George will just purchase the desk and chair. How can George determine the best action to take using a Sales Data worksheet The numerator of a rational number is 7 less than the denominator .If the denominator is increased by 9 and the numerator by 2, we again get the same rational number. Find the Number Thomas is a marathon runner. He eats a well-balanced diet and drinks plenty of fluids, but he should take supplements to account for all the calories he loses while running.E2020 Given m|n, find the value of x.(8x+6) (9x-30) Question 2 (1 point)(03.01 LC)What is the length of leg y of the right triangle? (1 point)a- 2b- 8 c- 12d- 35 Which detail about the box suggests something sinister ?