can anyone help me with this question? Thank you.

Can Anyone Help Me With This Question? Thank You.

Answers

Answer 1

Answer:

At B part.

Explanation:

At B part the nightfall will happen first because the B part is in the shade and will not present in front of the sun. When the earth rotates its own axis, the shaded part which is B comes in front of sun which means day time is started while on the other hand, the A part is in the shade and will experience nightfall so we can say that the nightfall occurs at B part of the earth.


Related Questions

Question 2 of 10
What is the term for the condition of the atmosphere in a given area at a
given time?
A Weather
B. Latitude

C Climate
D. Altitude
SUBMIT
Need ASAP

Answers

A is the answer to this

Answer:

A .Weather

Explanation:

The state of atmosphere over an area at any point of time is known as weather. It is the state of the atmosphere over short periods of time. ... Precipitation, humidity, temperature, pressure, cloudiness, and wind are the basic atmospheric conditions that make up the weather of a region.

Because conservation means using fewer natural resources and reducing wastes, it helps
a.
slow overpopulation and grow food.
b.
prevent habitat destruction and reduce pollution.
c.
prevent biodiversity and destroy species.
d.
stop exotic species and create habitats.


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

a

Explanation:

just did it

Answer:

the answer should be "B"

What two taxon make up the scientific name? Pick all that apply.
Kingdom
Phylum
Class
Order
Genus
Family
Species

Answers

Answer:

genus and species are combined to form a scientific name

Answer:

GenusSpecies

Explanation:

The word is genus and species. These two taxon make up the scientific name.

Why do potato plants no longer need to use glucose from starch in respiration once they have grown above ground?

Answers

They no longer need the respiration to grow

pls help ASAP i will mark brainliest

Answers

Answer:

ok

i can help you ..............

Explanation:

drop in the air pressure objects small mammals and insects in many ways mice and mouse are good weather indicators people who spend a lot of time outdoor have obeserved that field mice come out there holes squeak and run around before a storms appearce.

What is the source of the carbon dioxide that is used in photosynthesis?

Answers

Answer:

Photosynthetic cells

Explanation:

photosynthetic cells are diverse and are found in green plants during the process of photosynthesis cells use carbon dioxide and energy from the sun to make sugar molecules and make oxygen

which two molecule do green plants use to make glucose

Answers

Answer:

Carbon Dioxide and Water

What could be inferred from suntans?

Group of answer choices

A tan might indicate sun damage to the skin.

Tanning produces healthier skin.

A tan strengthens the elastic in the skin.

Tanning makes skin look younger.

Answers

Answer:

A tan might indicate sun damage to the skin.

Explanation:

Tanning is the process by which the skin is exposed to the ultraviolet rays that comes from the sun with the purpose of producing a dark-brown coloration called a TAN.

A tan achieved by exposure to the sun can actually indicate that a person's skin is undergoing damage from the UV rays of the sun, hence, the skin responds by producing a protein called melanin, which protects the skin and later forms the dark coloration- tan. From this explanation, tan is got in response to a damaging signal received by the cell, hence, a tan might indicate sun damage to the skin.

Question # 1: Which shape is CLOSEST to the truth for the shape of planet 1 point
Earth?
1. Which object best represents a true scale model
of the shape of Earth? (1) a table tennis ball
(2) a football (3) an egg (4) a pear
Option 1
Option 2
Option 3
Option 4

Answers

Answer:

(1) a table tennis ball

Explanation:

The earth will most closely resemble any type of sphere or circular ball.

Meiosis makes sperm and egg cells which are called

A. Gametes

B. Somatics

C. Spindles

Answers

Answer:

A. Gametes

hope it is helpful to you ☺️

the answer is gametes


Which of the substances below are PRODUCTS of the overall chemical reaction of
photosynthesis?
A. ammonia
B. Unitrogen
C. carbon dioxide
D. water
oxygen
sugars

Answers

Answer:

essentially glucose and oxygen are the products of photosynthesis

Explanation:

Macroscopic urinalysis collects data on all EXCEPT which of the following?
A. turbidity
B. color
C. pH
D. odor

Answers

Answer:

The correct answer is - pH.

Explanation:

Macroscopic urinalysis is the evaluation of the physical appearance of the urine. It evaluates the amount, color, odor and clarity, and other physical appearances or characteristics.

It also checks if there are any clotting, or sediments are found in the sample. It does not include the pH of the urine in the microscopic urinalysis. It is recommended to check underlying medical conditions.

natural selection selects ___________ less fit individuals .
natural selection selects ____________ viable individuals .

Answers

Answer:

viable

Explanation:

Only the animals who are able to survive will live long enough to reproduce

A cactus is adapted for life with limited water. The green
part of this cactus is its stem. Its stems are fleshy and
have a thick waxy coating.
What are two ways the structure of this cactus's stem helps the plant survive?
A. It takes in minerals from the soil.
B. It prevents water loss.
C. It carries out photosynthesis.
D. It holds the plant in the ground.

Answers

Answer:

i think its B hope it helps

Explanation:

Adaptations are the alteration that allows the survival of the fittest. The adapted structure of the cacti allows it to take the minerals from the soil and prevents water loss. Thus, options A and B are correct.

What are adaptations of cactus?

Adaptation is seen as the modified physical and chemical characteristics that allow the organism to survive in stressful conditions. A cactus has adapted spines, roots, waxy skin, and deep-layered stomata.

These adaptation has allowed the cactus to survive the harsh conditions of dessert. The wide fibrous roots allow it to draw nutrients and minerals from the soil.

The thick, expandable stem with deep-layered stomata prevents the loss of water from the surface in high-temperature conditions and keeps the plant hydrated.

Therefore, options A and B. the adapted attributes of cacti prevent water loss.

Learn more about adaptations here:

https://brainly.com/question/12501143

#SPJ5

hiii! ill give brainliest if u answer this :))

Why are enzymes important?

1. They contain the genetic material.

2. They speed up chemical reactions.

3. They bring water into the cell.

4. They help the cell maintain its shape.

Answers

They speed up chemical reactions

What is the function of the class of macromolecules represented in the following diagram

Answers

Answer:

lods ayarn na:)

Explanation:

The four classes of biological macromolecules are (1) Proteins, (2) Lipids, (3) Carbohydrates, (4) Nucleic Acids.

Proteins are made up of amino acids linked by peptide bonds. They have multiple functions, depending on the number of amino acids and its specific sequence. They serve as major workers composing motor and structural elements in the cell. They can also function as catalytic proteins (enzymes), as well as helpers for storage, signal, transport, reception, defensive, and contractile tasks.

Lipids are made up of fatty acids (a carboxylic acid with a hydrocarbon chain + terminal carboxyl group) and glycerols (organic compound made up of multiple hydroxyl groups). They are a hydrophobic compound that are used for energy storage, thermal insulation, protection, and chemical messengers. Lipids also regulate membrane permeability and aid in fat soluble vitamin production.

Carbohydrates are made up of monosaccharides which build up a polysaccharide (carbohydrates). Monosaccharides are basic sugars which cannot be broken down anymore by water (glucose, fructose, galactose). Carbohydrates' major functions include energy provision, blood glucose regulation, biological processes recognition, and breakdown of fatty acids for ketosis prevention.

Nucleic acids are made up of nucleotides which are organic molecules that forms the Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA). Their structure consists of a nitrogenous base, pentose, and an attached phosphate group. The function of nucleic acids are the creation and storage of genetic information.

mango tree and Vanda ecological interaction​

Answers

Answer:

The relation between a mango tree and an orchid is commensalism. An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are plants growing on other plants which, however, do not derive nutrition from them.

hope it helps

There are 20 different types of amino acids, which can result in a wide variety of protein shapes. Which of the following is not a function associated with proteins?
A. providing structure
B. speeding up chemical reactions as enzymes
C. information storage
D. all of these are functions of proteins​

Answers

Answer:

c information storage

Explanation:

information is stored in dna which provides the instructions required to make proteins . proteins do not store information

What molecule forms a double helix structure composed of two complimentary strands of nucleotides?

Answers

DNA! the question is a typical descrption of it


What type of RNA acts as a temporary copy of DNA's instructions and provides details on how to assemble a polypeptide
chain?

Answers

Answer:

messenger RNA (mRNA)

Explanation:

mRNA or messenger RNA is one of the three types of RNA molecules (the other being tRNA and rRNA) that is specifically responsible for carrying genetic information previously encoded and stored in the DNA into the ribosomes for translation to occur.

The process of translation results to the synthesis of amino acid sequences, which make up a polypeptide. Hence, it can be said that mRNA is that type of RNA that acts as a temporary copy of DNA's instructions and provides details on how to assemble a polypeptide chain.

Starch is a polysaccharide used as a component of cell walls in plants.


True

False

Answers

Answer:

false

Explanation:

is type of carbohydrates

False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.

What are structural component of cell wall?

Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.

Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.

Learn more about cell wall, here:

https://brainly.com/question/965751

#SPJ2

Which type of weather is associated with the eye of the hurricane?

calm

stormy

windy weather

Answers

Answer:

A windy weather

Explanation:

Tree will began to swayed

Describe the processes involved in photosynthesis

Answers

Explanation:

During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. ... Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.

Answer:

During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.

I’m 98% sure it’s c but it might be B could someone check pls

Answers

Answer:

I think C

Have a great day

[tex]#Liliflim✌[/tex]

Answer:

Explanation:

A

species I
species II
species III
species IV

Answers

Answer: It’s species II because it matches the unknown

two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad

Answers

Answer:

A. wheter the producers are located on land or in the water.

the tRNA for GUCAUCGAUCGAUCGGAUGCC

Answers

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

Many functions in the body are controlled by
special compounds. Which statements about
these compounds do you think are true? Check
all that apply.
The body can make all of the compounds it
needs.
.
The body gets energy from some
compounds.
um
Some compounds determine physical
characteristics.

Answers

Answer:

Its either a or b

Explanation:

A say the body can make all of the compound its need

my suggestion compound are made up of water ,mineral protein carbs and fat

our body produce little nutrients so we need to eat to get the nutrients we need

im am going with b

B is the answer



What is the
Magnification
of a plant cell?

Answers

Answer:

400x

Explanation:

PLEASE HELP WILL MARK BRANLIEST!
Fungi and bacteria are examples of _____:

A. decomposers, B. producers, C. consumers, D. demagorgans

Answers

Answer:

a. decomposers

Explanation:

Bacteria and fungi are best classified as decomposers. They decompose the bodies of dead plants and animals.

Other Questions
A 18 resistance is cut into three equal parts and connected in parallel. Find the equivalent resistance of the combination. 1. In what direction does the Earth rotate? Which expression has an equivalent value to x2 + 9x + 8 for all values of x?(x + 1)(x + 8)(x + 2)(x + 6)(x + 4)(x + 4)(x + 5)(x + 4) 2x - y = 5x + y = 2Solve the system of equations. Who rode, by horse, from Boston to Concordwarning locals that the British were coming?A. John HancockB. Paul RevereC. John AdamsO D. Sam Adams A manufacturer reports the information below for three recent years. Year 1 Year 2 Year 3 Variable costing income 140,000 146,400 143,950 Beginning finished goods inventory (units) 0 2,200 1,700 Ending finished goods inventory (units) 2,200 1,700 1,800 Fixed manufacturing overhead per unit 1.20 1.20 1.20 Compute income for each of the three years using absorption costing.Year 1 Year 2 Year 3Absorption costing income 23 points help plzzzWhich number is an integer? O -3/4 O 1/5 O 2 O 4 2/3 Fill in the blank in the dialogue with the most appropriate word.-Compraste algunos postres?- No, no compr. postre.A. algnB. ningunoc. algunoD. ningnSULLUT how does the mitochondria lysosomes and golgi apparatus work together To simplify 8.3 4 15 ( 6.1 + 12 ) , which operation must be performed first? In the lab activity, you will use a chemical called a pH indicator that changes color as the pH of asolution changes. If you added a pH indicator to two different solutions and they both turned thesame color, what would this tell you about the pH of each solution? Santiago goes to a Gypsy to ask her about his dreams. What does she tell him?Question 2 options:That he will never accomplish his dreams and that he would be a fool to follow themThat dreams are the language of God and that he will be successful on his tripThat she should go in his place, so that she can find the treasure.That she knows exactly where the treasure is, so therefore he needs to give her half of it. please answer this question Help ASAP please how can I solve this please due at 12:30 need helps What is some of the figurative language out of Bohemian Rhapsody By QueenI need 7 and here are lyricsIs this the real life?Is this just fantasy?Caught in a landslideNo escape from realityOpen your eyesLook up to the skies and seeI'm just a poor boy, I need no sympathyBecause I'm easy come, easy goLittle high, little lowAny way the wind blowsDoesn't really matter to me, to meMama, just killed a manPut a gun against his headPulled my trigger, now he's deadMama, life had just begunBut now I've gone and thrown it all awayMama, oohDidn't mean to make you cryIf I'm not back again this time tomorrowCarry on, carry on as if nothing really mattersToo late, my time has comeSends shivers down my spineBody's aching all the timeGoodbye, everybody, I've got to goGotta leave you all behind and face the truthMama, ooh (Any way the wind blows)I don't want to dieI sometimes wish I'd never been born at allI see a little silhouetto of a manScaramouche, Scaramouche, will you do the Fandango?Thunderbolt and lightning very, very frightening me(Galileo) Galileo(Galileo) GalileoGalileo FigaroMagnifico-o-o-o-oI'm just a poor boy, nobody loves meHe's just a poor boy from a poor familySpare him his life from this monstrosityEasy come, easy go, will you let me go?Bismillah! No, we will not let you go (Let him go!)Bismillah! We will not let you go (Let him go!)Bismillah! We will not let you go (Let me go!)Will not let you go (Let me go!)Never let you go (Never, never, never, never let me go)Oh oh oh ohNo, no, no, no, no, no, noOh, mama mia, mama mia (Mama mia, let me go)Beelzebub has a devil put aside for me, for me, for meSo you think you can stone me and spit in my eye?So you think you can love me and leave me to die?Oh, baby, can't do this to me, babyJust gotta get out, just gotta get right outta hereOoooh, ooh yeah, ooh yeahNothing really mattersAnyone can seeNothing really mattersNothing really matters to meAny way the wind blows... plzz helpp all of this is due today :( Biologists expect that all cells come from other cells because of theHookecell theory endosymbiosis theoryosmosis In order for an effective periodic review, you should:O A. spend time making personal connections.O B. reread assignments daily.O c. make note cards.O D. collect the chapter summaries in one place. What key point/s did you get from source 1? source 2? source 3?source 1. What key point/s did you get from Source 1? Source 2?Source 3? Source 4?2. What similarities and differences did you identify from thesources Express tan J as a fraction in simplest form