1. Which word or words go with easier?
a)mediocre

(b) convenient
(c) ravenous
(d) captive
the litary

2. Which wart or words go with less of freedom
(a) course
(b)accompany
(c)bondage
(d) captive
3. Winch word or words go with helpful?
(8) prefer
(b) linger
(c) interpret
(d) beneficial
4. Which word or words go with happiness?
(a) supplement
(bl bliss
{c) ecstasy
(d) monotony
5. Which word or words go with slow?
(a) linger
b) accompany
(c) supplement
(d) saunter
6. Which word or words go with clumslly done?
a) retrieve (b) bungle
c) convenient
(d) inept
7. Which word or words go with wide open spaces?
(a) captivity (b) expanse
(c)territory
(d) supplement

Answers

Answer 1

Answer:

1: Which word goes with easier: Convenient.

2: Which word or words go with less freedom: Captive.

3: Which word or words go with helpful: Beneficial.

4: Which word or words go with happiness: Bliss.

5: Which word or words go with slow: Saunter.

6: Which word or words go with done clumsily: Inept.

7: Which word or words go with wide open spaces: Expanse.

Explanation:

You had a few grammar errors, so I fixed them! Hope this helps!

Answer 2

Answer: 1 (b), 2 (d), 3 (d), 4, (b) & (c) both mean the same thing, 5 (d), 6 (b), 7 (c)

Explanation: Not sure about 6 heh


Related Questions

Read the following excerpt from “The Gift of the Magi” and answer the question.

For there lay The Combs--the set of combs, side and back, that Della had worshipped long in a Broadway window. Beautiful combs, pure tortoise shell, with jewelled rims--just the shade to wear in the beautiful vanished hair. They were expensive combs, she knew, and her heart had simply craved and yearned over them without the least hope of possession. And now, they were hers, but the tresses that should have adorned the coveted adornments were gone.

But she hugged them to her bosom, and at length she was able to look up with dim eyes and a smile and say: "My hair grows so fast, Jim! And them Della leaped up like a little singed cat and cried, "Oh, oh!" Jim had not yet seen his beautiful present. She held it out to him eagerly upon her open palm. The dull precious metal seemed to flash with a reflection of her bright and ardent spirit."Isn't it a dandy, Jim? I hunted all over town to find it. You'll have to look at the time a hundred times a day now. Give me your watch. I want to see how it looks on it."

Instead of obeying, Jim tumbled down on the couch and put his hands under the back of his head and smiled."Della," said he, "let's put our Christmas presents away and keep 'em a while. They're too nice to use just at present. I sold the watch to get the money to buy your combs. And now suppose you put the chops on."

The magi, as you know, were wise men--wonderfully wise men--who brought gifts to the Babe in the manger. They invented the art of giving Christmas presents. Being wise, their gifts were no doubt wise ones, possibly bearing the privilege of exchange in case of duplication. And here I have lamely related to you the uneventful chronicle of two foolish children in a flat who most unwisely sacrificed for each other the greatest treasures of their house. But in a last word to the wise of these days let it be said that of all who give gifts these two were the wisest. O all who give and receive gifts, such as they are wisest. Everywhere they are wisest. They are the magi.

What inference can the reader make about Jim’s feelings based on his actions at the end of the passage?

Jim feels contentment with knowing that, although their gifts are useless, their love for each other is strong.
Jim feels helpless to provide a better life for Della.
Jim feels indifference about the outcome since his gift was not costly.
Jim feels frustration because of the ruined gift.

Answers

Answer:

A: Jim feels contentment with knowing that, although their gifts are useless, their love for each other is strong.

Explanation:

Will mark brainliest!!!

Read the excerpt from paragraph 1.


We remember a time when the Potomac River was choked with algae. When Lake Erie was dying. When too many coastal waters were degraded. When too many urban rivers and beaches were open sewers. When too many communities didn't have clean, safe water they could depend on.


Which two statements describe how Gore uses rhetoric to advance a point of view in this paragraph?



He uses the bandwagon appeal to suggest that he is part of a group of people who are making good environmental choices.



He uses ethos to establish credibility and build the audience's trust about his environmental expertise.



He uses logos to build a reasonable argument about the importance of environmental policy.



He uses parallelism to emphasize some of the environmental problems Americans had to solve.



He uses figures of speech to encourage the audience to imagine new environmental futures.



He uses pathos to provoke the audience's emotional response toward environmental problems.

Answers

The two statements that describe how Gore uses rhetoric to advance a point of view in this paragraph are:

He uses parallelism to emphasize some of the environmental problems Americans had to solve.He uses pathos to provoke the audience's emotional response toward environmental problems.

In this passage, the author Gore used the rhetorical appeals of parallelism ad pathos. Parallelism is the repetition of the same grammatical forms in a series of sentences.

The repetition of 'When' allows for parallelism.

Also, pathos, which is an appeal to emotions was used to stress the former pitiable condition of the people.

Learn more about pathos here:

https://brainly.com/question/13118125

Answer:

He uses parallelism to emphasize some of the environmental problems Americans had to solve.

He uses pathos to provoke the audience's emotional response toward environmental problems.

Explanation:

proof


Happy to help !!

State the relationship between the settings and the mood of the novel To Kill a Mockingbird​

Answers

Answer:

Explanation:

To Kill a Mockingbird takes place in Maycomb, Alabama during 1933–1935. These years place the events of the novel squarely within two important periods of American history: the Great Depression and the Jim Crow era. The Great Depression is reflected in the poverty that affects all of the residents of Maycomb. Even the Finches, who are objectively better off than many of the other citizens in the area, are ultimately poor and living within the means available to them. The years depicted in the novel also fall within the much longer period of time that modern historians often refer to as the Jim Crow era. This term describes the time from the late 19th century until the mid-1960s when black people in the United States could no longer be held in slavery, but where laws limited the social, political, and economic possibilities available to black citizens. We should remember that when Harper Lee wrote the novel in the late 1950s, the Great Depression was over, but Jim Crow laws were still present in substantial portions of the American South.The fictional town of Maycomb, in the fictional Maycomb County, seems intended not to represent an exact location in the real world, but a kind of small Southern town that existed in the 1930s. Scout describes the town as old, tired, and suffocating. In addition to being literally appropriate, these descriptions also apply to more subtle social aspects of the town. The town is burdened, Atticus might say diseased, by social prejudices in general, and racism in particular. Maycomb is also sharply geographically divided along class lines. While more prosperous families like the Finches live in large houses close to the center of town, the Ewells live in a ramshackle cabin near the dump, out of sight of the rest of the town except at Christmas, when people drive their trees and trash to the dump. The only other dwellings in this area are the cabins where black families live, an indication that the town is both racially and economically segregated. The Ewells lack basic necessities like running water and insulation, and they frequently forage in the dump for food. “Every town the size of the Maycomb had families like the Ewells,” Scout says, implying that the economic inequality is endemic to the region.

why has freedom been such an important ideal over the course of amer history

Answers

Answer:

For Americans, independence is a prime motivator for self-determination, reflected in the bravery of the early colonists and those who marched westward to create new lives, homes, and communities. Various freedoms are also guaranteed in the Bill of Rights, the first ten amendments to the Constitution.

Answer: The American Dream is a national ethos of the United States, the set of ideals (democracy, rights, liberty, opportunity and equality) in which freedom includes the opportunity for prosperity and success, as well as an upward social mobility for the family and children, achieved through hard work in a society with few ...

Chameleons are usually green, brown, or gray. But they can change color.
Some chameleon species can only turn brown or green. Others, however,
can turn shades of yellow, orange, white, black, and even blue.

Answers

Answer:

yes? what is the question withint this

Explanation:

(1) Most Americans know that “Uncle Sam” is a nickname for the United States; however, few Americans know how the name originated. (2) Some historians believe the name comes from a nineteenth-century businessman from New York. (3) His real name was Samuel Wilson. (4) His neighbors called him Uncle Sam. (5) During the War of 1812, he won a government contract. (6) He was to supply beef to U.S. soldiers. (7) The beef was packed in barrels labeled “U.S.” to show that they belonged to the U.S. government. (8) Soldiers from New York saw the barrels. (9) They jokingly said “U.S.” stood for Uncle Sam Wilson. (10) The joke spread. (11) Soon, soldiers began using the nickname Uncle Sam to refer to the United States. (12) Civilians also began using the nickname Uncle Sam to refer to the United States. (13) In 1961, Congress recognized Samuel Wilson. (14) It passed a resolution honoring him as the original Uncle Sam. Which is the most effective way to combine sentences (11) and (12)?

Answers

Answer:

Soon, soldiers and civilians began using the nickname Uncle Sam to refer to the United States.

Explanation:

Sentences 11 and 12 are both talking about "using the nickname Uncle Sam to refer to the United States".

In sentence 11, it talks about soldiers. In sentence 12, it talks about civilians.

You can say:

Soon, soldiers and civilians began using the nickname Uncle Sam to refer to the United States.

Can you make an original Rube Goldberg system for me? Don't make it too hard but make it cool and name the resources. Need this by tomorrow. Also, a Rube Goldburg system is like a domino effect.

Answers

I made a ramp and dropped a ball which hit the Domino's and hit another ball which then rolled down another ramp hit more Domino's and the Domino's hit the third ball into a cup and the cop flew into the air when the ball landed in it

Tape

Styrofoam

Dominos

Marbles

Plastic cup

String

Cardboard

Which rhetorical feature included in the ""Bill of Rights"" is not included in the excerpt from ""Federalist Paper No. 51""?

Answers

Answer:

Federalist Paper 84 argued that the Constitution didn’t need one immediately, but amendments could be added later. Read more about the question “why do we need the Bill of Rights” and Federalist 84. Federalist 84 Addresses Objections. One of the primary objections to the Constitution was that it contained no bill of rights. The Federalist ...

Explanation:

What does this mean? (Riddle)

I scamper and scurry
Away in a hurry
I will not get caught you just trust me don’t worry
I leave with my prize
Watched by great yellow eyes
A morsel of gouda of notable size

Answers

Answer:

A rat trying to get cheese, and hurrying before they get caught to their own demise. My best guess so if this is wrong I'm so sorry T^T

Explanation:

Use a comparative or a superlative to complete the sentence.1. I’ve never thrown the javelin as far as that – nearly 30 metres! That’s the …………………I’ve ever thrown the javelin – nearly 30 metres!

Answers

Answer:

That’s the farthest I've ever thrown the javelin – nearly 30 metres!

Select the correct text in the passage. Which sentence contains the main idea of the paragraph? Now you can stop feeling guilty about that bite of chocolate you had for dessert. Chocolate has been found to be a cause of weight gain. But chocolate does have some health benefits. However, don’t reach for that chocolate cake just yet. Researchers found that only people who had an average of one ounce of dark chocolate per day received the health benefit. Dark chocolate is full of flavonoids, which can help prevent diseases. Flavonoids have been found to decrease cholesterol and reduce the blood clots that cause strokes. Flavonoids also boost a natural chemical in your brain called serotonin. Low serotonin can cause depression. That’s probably why eating chocolate boosts mood and feelings of well-being.

Answers

Answer:

"Researchers found that only people who had an average of one ounce of dark chocolate per day received the health benefit" is the main idea.

Explanation:

Trust me

She needs three t_ _ _ _ _ _ _ to make a pizza.

Answers

Answer:

She needs three toppings to make a pizza.

Hope this correct.

Explanation:

She needs 3 TOPPINGS to make a pizza.

Please, someone, help me with this asap!

Answer the following questions in complete sentences:

1. What are patronymic names? What are matronymic names?

2. Give three examples of prefixes or suffixes used to indicate patronymic names and an example of each (ex. -son, Erickson). Do not use the example.

3. Explain how nicknames became surnames.

4. Give five examples of surnames that were nicknames.

5. Were all occupational names given literally the occupation of the person given the name?

6. What is one reason a person might have received an ornamental or acquired name? (Answer in complete sentences).

7. Give five examples of place or location names.

Answers

1. patronymic, name derived from that of a father or paternal ancestor, usually by the addition of a suffix or prefix meaning “son.”

2.

Which phrases are examples of sensory imagery that make the details of the setting more vivid? Choose three answers.

crops withered, curled up, then died under the thirsty sun
morning in July a hurricane came out of the east
snapping their roots and tearing them out of the earth
a voice that seemed to rumble out of the earth itself
prodding each other and giggling, went back to the house

Answers

Answer:

a) crops withered, curled up, then died under the thirsty sun.

d) a voice that seemed to rumble out of the earth itself.

e) prodding each other and giggling, went back to the house.

Explanation:

The example of sensory imagery that makes the details of the setting more vivid would-be Options A, D and E.

Option A: sensory language = withered, curled up, thirsty It describes the appearance of the crops and the sight or feel of the sun. Visual imagery

Option D: sensory language = voice that rumble out of the earth It describes the sound of the voice which sound like it came deep down the earth.  Auditory imagery

Option E: sensory language = prodding, giggling It describes the movement of the subject which is poking and giggling as they went to the house. Kinesthetic imagery

Answer my question plzzz!!
What is the theme?
AND
What is the topic and the message of the story?

Answers

A Theme is a set of colours,fonts,effects and more that can applied to your entire presentation to give it a consistent,professional look.

Guys patulong Poooo i need naaaaaaaa​

Answers

Answer:

woah man

Explanation:

what is the correct meaning of the word emphatically

Answers

Answer:

To do something forcefully or To do something without a doubt

Explanation:

why does lennie say “i don’t like this place George. this ain’t no good place. i wanna get out of here”

Answers

Lennie's intuition leads him to warn George that the bunkhouse and the ranch aren't a good place for them to be. He instinctively knows there's something ...

what was the setting in chapter 3 of lightning thief? (pls give me quotes from the text)

Answers

Percy takes a cab home to his mom's apartment in Manhattan. Percy is greeted by Gabe Ugliano (a.k.a. "Smelly Gabe"). “I wish he could see you, Percy. He would be so proud.”

What happens at the end of loser by jerry spinelli

Answers

Answer:

with a chapter from the perspective of some other boys at zinkoffs school

Answer: The novel ends with a chapter from the perspective of some other boys at Zinkoff's school. From a distance they tease Zinkoff and talk about what a loser he is. One boy explains what happened when Claudia went missing, leading another boy to wonder what it would be like to be so cold for seven hours.

The main function of the final sentence of paragraph 2 (“Darrow was self-made, working hard to reach the pinnacle of the legal profession.”) is to

Answers

The main function of the sentence at the end of the paragraph is to finish the introduction about Darrow by completing the basic information about him.

We can arrive at this answer because:

The first two paragraphs of the text serve as an introduction to Darrow to the reader.This introduction should be concluded with a specific thought, which concludes it, but allows the information to be extended throughout the text.

In this case, the sentence shown in the question, ends the introduction about Darrow, concluding the basic information about him, but allowing more information to be presented throughout the text.

More information on text introduction at the link:

https://brainly.com/question/11994283

1. Twelfth Night contained a lot of figurative language. What is it?

A) A figure of speech where the author refers to a subject matter by way of a passing reference

B) The process wherein an author introduces and then describes a character

C) A form of writing where the writer uses exaggeratedly complex sentences to convey a meaning that could have been conveyed through a much simpler sentence

D) Phrasing that goes beyond the literal meaning of words to get a message or point across

Answers

When a person says that a drama like Twelfth Night contained a lot of figurative language, this means:

C. A form of writing where the writer uses exaggeratedly complex sentences to convey a meaning that could have been conveyed through a much simpler sentence.

Figurative language has to do with the various ways through which a writer expresses himself and his thoughts by making use of more complex terms rather than much simpler ones.

With this in mind, when a person says that a drama was written and contained a lot of figurative language, then he simply means that there were complex words used. Most times these are used forr dramatic effect or to increase the appeal to the audience.

Some examples of figurative language includes: simile, metaphor, pun, etc.

Therefore, the correct answer is option C

Read more about figurative language here:

https://brainly.com/question/8226026

Fill in the blank to explain how Ernesto and Tami resolve their problem .

Answers

The blanks have been filled to explain how Ernesto and Tami resolve their problem  as follows:

Ernesto offers to help Tami even though he doesn't have time. In return, Tami agrees to help Ernesto pick a book for his club. They are both happy to finally be able to plan their homework.

The context of the passage suggests that the two friends have a hard time completing their homework. Ernesto has a lot to do but still helps Tami with his work.

Tami returns the help by helping Ernesto pick a book for his club. In the end, they are both happy to have helped each other plan their homework.

Learn more about problem resolution here:

https://brainly.com/question/10708306

Answer:

like science

Pick

Spend time together

Explanation:

I just got a quiz

Examine the following PSA.


A poster of a man asleep in a chair holding a lit cigarette that reads, "Cigarettes don't know when you are asleep. Smoking is the #1 cause of home fire deaths. If you smoke, put it out. All the way. Every time."

Which elements are included in this PSA? Check all that apply.


a fact or statistic

a chart or diagram

a call to action

a personal testimonial

a strong, memorable image

Answers

Answer:

a fact or statistic

a call to action

a strong, memorable image

a fact or figure.a request for action.a potent, lasting impression.What is PSA certified?

A security certification program called Platform Security Architecture (PSA) Certified is available for Internet of Things (IoT) hardware, software, and devices. It was developed as part of a global collaboration between Arm Holdings, Brightsight, CAICT, Prove & Run, Riscure, TrustCB, and UL.

To provide uniform standards for IoT security, Arm Holdings originally proposed the PSA specifications in 2017. The PSA Certified assurance program was then introduced in 2019.

A standard for IoT security was developed by Arm Holdings in 2017 and is called Platform Security Architecture (PSA). Between Internet of Things services and devices, the standard fosters confidence. It was designed to incorporate a wide range of requirements, including threat models, security evaluations, specifications for the hardware and firmware architecture, and a reference firmware implementation that is open-source.

Learn more about PSA certified, from:

brainly.com/question/29710203

#SPJ2

an american draft dodger in thunder bay number of stanzas

Answers

Answer:

If I am not mistaken there is 41 lines total in the song.

Explanation:

Lyrics

He was born in a small town

And he was given every reason to stay

Hallelujah, Mississippi, postcard living no sign of decay

'Til Vietnam moved next door, then Hallelujah was off to war

In the dream he couldn't finish the deed

He didn't smoke any weed so why leave?

Going where I can't be found

And I won't be coming 'round

His father Tom said you better sign on

You'd better take up your gun and fight

I got nothing against them Viet Cong

What did they do wrong and why am I right?

He's on his way to Thunder Bay

Crossed the border late at night

And it was high stakes until he saw the Great Lakes

And he felt the cold wind bite

Going where I can't be found

And I won't be coming 'round

No, I'm an American on the Canadian Shield

And I'm putting down roots in your frozen fields

It gets cold but you feel so good

To be a stranger in town and you're understood

Missing his home, he would wake up in a cold sweat

And pick up the phone and hope that Tom found a way to forget

He's been teaching at the high school, learning the game

In Thunder Bay we're all the same

He's one of us, he has our trust

But there's no going back once the line is crossed

I'm an American on the Canadian Shield

And I'm putting down roots in your frozen fields

It gets cold but you feel so good

To be a stranger in town and you're understood

You can't ask what you're asking me to do

And I hope you understand when I refuse

I'm going North with my point of view

And I'm never gonna think the same as you

And I'm where I can't be found

And I won't be coming round

No I'm an American on the Canadian Shield

And I'm putting down roots in your frozen fields

It gets cold but you feel so good

To be a stranger in town and you're understood

How is Academic English as a second language acquired?
What are the best research based practices teachers can utilize to assist students in acquiring Academic English as a second language?

Answers

1) the direct method
2) the grammar translation method
3) the audio lingual method
4) the structural approach
5) the silent way
6) communicative language teaching (CTL)

What your cover page looks like says nothing about the content inside.

Answers

Answer:

id disagree. the cover of the page is to purposely relate to the content inside and give possible readers a sense of intrigue.

D. will not be scored
3.
You can save your place in the course by
A. adding the page to your browser favorites
B. clicking on the bookmark icon at the top of the course page
C. adding the page to your browser bookmarks
D. asking your instructor to save your location

Answers

Answer:

c!!

Explanation:

You can save your place in the course by is option B i.e  Clicking on the bookmark icon at the top of the course page.

What do you understand by Bookmarking?

Bookmarking is an internet based assistance which permits clients to add, explain, alter, and share bookmarks of web reports. Numerous web-based bookmark the executives administrations have sent off beginning around 1996 Delicious, established in 2003, promoted the expressions social bookmarking and labeling.

Bookmarking Websites additionally called social bookmarking permit clients to save and share connects to sites or intriguing articles with others.

This is a decent answer for putting away and sorting out joins significant for us. Bookmarks are most frequently labeled which permits ensuing clients to look for them by subject.

Social bookmarking is the most common way of labeling a site page with a program based instrument so you can undoubtedly visit it once more at a later time.

Rather than saving web-based entertainment presents on your program bookmarks, you can utilize various stages' highlights to bookmark posts.

In basic words, it is the demonstration of labeling a site and saving it for sometime in the future and reference. These labeled sites are saved money on the web rather than the your own internet browser.

It empowers clients to add, clarify, alter and share bookmarks of the sites. Social bookmarking is an integral asset in advancing a site.

For more information about Bookmarking, refer the following link:

https://brainly.com/question/3955863

#SPJ2

Can someone help me come up with a thesis for my essay.

The main topic is how students should not have homework over breaks.

Answers

They shouldn’t when your working a job you don’t do work on a break do you
Students should not have homework during breaks because it helps them relax and calm their anxiety during their free time, and is easier for teachers with grading.

what is the correct meaning of the word abdide

Answers

Answer:

Explanation:

accept or act in accordance with (a rule, decision, or recommendation)

Abide means to accept, or to act according too; agree.

For example: "I said I would Abide by their rules" - I would accept/follow their rules.

Other Questions
What do you think Madison needs to include in the fire prevention training plan? Which statement best explains how the animals in the diagram contribute to the carbon cycle?AThey eat plants and other organisms that contain carbon which prevents it fromever being Stored.BThey eat plants and other organisms which contain carbon and deposit carboninto the soil when they die.They remove carbon from the atmosphere during respiration and replace it withoxygen that is used in photosynthesis.DThey remove carbon from the soil during respiration and exchange it withoxygen that evaporates into the atmosphere. Which of the following goals is NOT a focus of typical community health promotion efforts? A. Lower prescription costs B. Long-term health C. Disease prevention D. Senior citizen health Please select the best answer from the choices provided. A B C D. Lyssa and Carlos own a hardware store. They sell a certain type of light bulb in packages that each contain 24 bulbs. The back of each package says, " The expected number of broken or defective packages per bulb is 0.25" Lyssa says, "If we look at 100 packages, we expect to see a total of about 250 broken or defectve bulbs" Carlos says, "Any given package most likely contains 0.25 broken or defective bulbs".Which Statement is correct based on the expected value?A. Only LyssaB. Only CarlosC. Both Statements are correct. D. Neither Statement is correct. Marko is playing the video game fort attack. The purpose of the game is to shoot invading bandits that are trying to breach the fort's circular wall, and marko must provide the angle at which the cannon should turn in order to shoot the attacking bandits. The bandit is attacking as pictured in the figure below:. Who is Francois Mauriac and why, according to the Preface/Foreword, does he help Wieselget published? How does Mauriac describe Wiesel? Use textual evidence to support youranswer:I a group of 3 people are sharing chocolates each person wants 8 chocolates and each box has 4 chocolates 5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark