Are the equations -3(2x+9)=12 and 2x+9=-4 equivalent?​

Answers

Answer 1
yes those two equations are equivalent
Answer 2
yes they are
Explanation: -3(2x+9)=12 when u divide -3 by 12 the equation turns into (2x+9)=-4 so they have to be equivalent

Related Questions

What is the volume of the rectangular prism?

A rectangular prism with dimensions 4 and 1 third feet by 3 and 1 third feet by 4 feet.
57 7/9ft3
11 2/3ft3
48 2/9ft3
28 2/3ft3

Answers

Answer:

A or 57 7/9ft3

Step-by-step explanation:

13/3x10/3x4/1 = 520/9=57 7/9

Answer:

The volume of the rectangle would be [tex]57\frac{7}{9}[/tex] ft^3. (The first answer).

Step-by-step explanation:

To solve you have to multiply [tex]4\frac{1}{3},3\frac{1}{2}, and, 4[/tex] to get an answer of [tex]57\frac{7}{9}[/tex].
I hope this helps! :)

How many inches around is the border if the diameter of the pizza is 8 inches?

Answers

Answer:

25.12

Step-by-step explanation:

Since it says around the pizza, we can assume it means circumference.

So, the formula to find circumference is C=2πr.

We have a diameter which is 8. We know that radius is half of the diameter. So, half of 8 is 4.

Now that we have the radius we can plug in the numbers for the formula C=2πr.

C=2πr

C=2*3.14*4

C=25.12

your answer is 25.12 inches.

opposite of expanded form ​

Answers

Answer:

factored form

Step-by-step explanation:

example

(x + 2)(x + 3) ← is an expression in factored form

= x² + 5x + 6 ← in expanded form

Answer:

factored form

Step-by-step explanation:

Factored form is opposite of expanded form.

More info:-

Expanded form:

[tex]\sf{5(x+7)=5x+35}[/tex]

Factored form:

[tex]\sf{5x+35=5(x+7)}[/tex]

Pls help to find intervals of increasing, decreasing, and range. Quadratic btw T-T

Answers

Answer:

left side:

Range: For all Y inside of Real, y>= -2

Increasing: (-2, inf) For all x inside of Real

Decreasing:(inf, -2)  For all x inside of Real

Right side:

Range: For all Y inside of Real, y<= 1

Increasing: (-1, inf) For all x inside of Real

Decreasing:(inf, 1)  For all x inside of Real

Given the circle has a radius of 9 and a center of (-6,4) what is the equation of the
circle?

Answers

Answer:

(x+6)2 + (y-4)2 = 81

Step-by-step explanation:

The equation of the circle is in the for (x-a)2 + (y-b)2 = c2

(Refer to the attached image)​

Answers

Answer:

missing side: 133 cm

Explanation:

Provided 2 length sides and one angle also need to find one missing side.

So, use cosine rule:

⇒ a² = b² + c² - 2bc cos(A)

Insert values

⇒ g² = 166² + 147² - 2(166)(147) cos(50)

⇒ g² = 17794.3935

⇒ g = √17794.3935

⇒ g = 133.3956

g = 133          (rounded to nearest whole number)

write an equation for a prabola with a vertex at the origin, passing through(5,6), and symmetric with respect to the x-axis

Answers

a parabola with symmetry or mirror image across the x-axis, will be a horizontal parabola, namely one that opens either to the right or left.

a horizontal parabola will be a parabola whose independent variable is the "y", so it'll be an x(y) type of equation.

[tex]~~~~~~\textit{horizontal parabola vertex form} \\\\ x=a(y- k)^2+ h\qquad \begin{cases} \stackrel{vertex}{(h,k)}\\\\ \stackrel{"a"~is~negative}{op ens~\supset}\qquad \stackrel{"a"~is~positive}{op ens~\subset} \end{cases} \\\\[-0.35em] ~\dotfill\\\\ \begin{cases} h=0\\ k=0 \end{cases}\implies x=a(y-0)^2+0\qquad \textit{we also know that} \begin{cases} x=5\\ y=6 \end{cases} \\\\\\ 5=a(6-0)^2 +0\implies 5=36a\implies \cfrac{5}{36}=a~\hfill \boxed{x=\cfrac{5}{36}y^2}[/tex]

f(x) = x². What is g(x)?​

Answers

Answer:

We want to get g(x) given that we know f(x) and the graphs for both functions. We will see ...

Step-by-step explanation:

Find the volume of this rectangular pyramid.
length =5cm
width =6cm
hight =7cm
PLEASE HURRY

Answers

Volume is just length x width x height. 5 x 6 x 7 is 210. 210cm


What is the equation of the line that passes through the point (-6, -7) and has a
slope of1/2?

Answers

Answer:

y =  x/2 - 4

Step-by-step explanation:

Determine whether each set of side lengths could be the sides of a right triangle. drag and drop each set of side lengths to the correct box. right triangle not a right triangle

Answers

The set of side lengths that could be the sides of a right triangle must follow the Pythagoras theorem

How to determine the side lengths?

The rule of the side lengths of a right triangle is:

[tex]c^2 = a^2 + b^2[/tex]

Where c is the length of the longest side, and a and b represent the lengths of the triangle

This in other words mean that:

All right triangles obey the Pythagoras theorem

Note that I gave a general explanation because the question is incomplete

Read more about right triangles at:

https://brainly.com/question/2437195

#SPJ4

Hunter picked three quarts of blueberries. some of the blueberries are ripe and some are not ripe. If he takes one blueberry from the basket without looking, what are the outcomes

Answers

Answer:

Berries with any blush of red are not ripe, yet may ripen further once picked if kept at room temperature. That said though, you really want to ...

A map shows that the vertices of a backyard are W(-100,-70), X(-100,0),Y(0,0), and Z(-60,-70) . The coordinates are measured in feet. The line segment XZ separates the backyard into a lawn and a garden. The area of the lawn is greater than the area of the garden. How many times larger is the lawn than the garden?

Answers

The area of the lawn is 2.5 times greater than the area of the garden.

What is Heron's formula in math?

Heron's formula for finding the area of a triangle in terms of the lengths of its sides.

In symbols, if a, b, and c are the lengths of the sides: Area = √s(s - a)(s - b)(s - c) where s is half the perimeter, or (a + b + c)/2.

Given vertices W(-100,-70), X(-100,0),Y(0,0), and Z(-60,-70) of a backyard,

We have to find distances WX, XY, YZ, ZW and XZ:

1. WX= √(-100+100)²+(0+70)²

=√0+4900

=70

2. XY= √(0+100)²+(0-0)²

=100 units.

3. YZ= √(-60-0)²+(-70-0)²

=√3600+4900

= √8500= 10√85

4. ZW= √(-60+100)²+(-70+70)²

=√40²+0

=40 units

5. XZ= √(-60+100)²+(-70+0)²

=√40²+70²

=√6500=10√65

Then:

1. the area of WXZ

[tex]\sqrt{(70+40+10\sqrt{65}) /2 * ({70+40+10\sqrt{65}) /2 -70* {(70+40+10\sqrt{65}) /2 -40[/tex]*[tex]\sqrt{(70+40+10\sqrt{65}) /2 -10\sqrt{65}[/tex]

=1400 feet²

Area of XYZ= [tex]\sqrt{(100+10\sqrt{65}+10\sqrt{85}) /2 * (100+10\sqrt{65}+10\sqrt{85}) /2 -100* {(100+10\sqrt{85}+10\sqrt{65}) /2[/tex]-[tex]\sqrt{-10\sqrt{85}*(10+10\sqrt{85} +10\sqrt{65}) /2 -10\sqrt{65}[/tex]

=3500 feet²

Then, ar(WXZ)/ ar (XYZ)= 3500/1400=2.5 times.

Learn more about heron's formula here:

https://brainly.com/question/20934807

#SPJ1

please help, i’ll give pointsssss :)

Answers

the slope of the line should be 2 because when using rise over run for the graph it is shown that the slope rises 2 and runs 1 meaning the fraction is 2/1 which when simplified is 2

Two similar triangles are shown below

Which two sets of angles are corresponding angles?

Answers

Answer:

I cant help unfortunately

Step-by-step explanation:

can you help me in the comprehension of the story uncle Marcos ?

My exam is in 4 hours btw

help solve these algebraic fractions please with explanation would be great <3​

Answers

Answer:

7/ Ans;

[tex] \frac{x + 2}{ x + 4} \div \frac{ {x }^{2} - 2x - 8}{ {x}^{2} + 2x - 8} \\ \\ \\ \frac{x + 2}{x + 4} \times \frac{ {x}^{2} + 2x - 8 }{ {x}^{2} - 2x - 8} \\ \\ \\ \frac{x + 2}{x + 4} \times \frac{(x - 2)(x + 4)}{(x - 4)(x + 2)} \\ \\ \\ =1 \times \frac{x - 2}{x - 4} \\ \\ \\ = \frac{x - 2}{x - 4} [/tex]

___o__o__

9/Ans;

[tex] \frac{ {x}^{2} - 9}{ {x}^{2} - 6x + 9} \div \frac{x + 4}{x - 3} \\ \\ \frac{ {x}^{2} - 9 }{ {x}^{2} - 6x + 9} \times \frac{x - 3}{x + 4} \\ \\ \\ \frac{(x + 3)(x - 3)}{(x - 3)(x - 3)} \times \frac{x - 3}{x + 4} \\ \\ \\ = \frac{(x + 3)}{1} \times \frac{1}{(x + 4)} \\ \\ \\ = \frac{x + 3}{x + 4} [/tex]

__o__o__

In the two questions, we first replace the division with multiplication with flipping the fraction after the division sign, secondly we analyze any equation that needs analysis to simplify it, thirdly, to simplify the fraction by deleting the numerator and the similar denominator .

Sean counts by 2s from 15 to 35. which number does Sean count?

HELP ME ASAP!!!

Answers

The number that Sean counts is 27.

What number does Sean count?

When Sean counts by 2s from 15 to 35, he would be counting odd numbers. An odd number is a number that cannot be perfectly divided by 2. There would always be a remainder.

Here are the options:

13

27

16

22

To learn more about integers, please check: https://brainly.com/question/21493341

#SPJ1

Question 5 and 6 I need answers to

Answers

Answer:

and also mark me the brainliest for the answer

Step-by-step explanation:

What is the equation of a line through the points (0,9) and (3,0)?

Answers

Answer:

The image has the ans.

Step-by-step explanation:

The image will help.

At a music academy, a randomly selected group of people were asked which type of musical instrument they are learning to play. The results are displayed, by age, in the two-way frequency table.

String Woodwind Piano Total
Ages 15-19 11 3 7 21
Ages 20-24 9 10 17 36
Ages 25-29 16 6 7 29
Total 36 19 31 86

Based on the data in the table, which statement is true?

A.
P(learning a string instrument) ≠ P(ages 20-24)
B.
P(playing piano|ages 25-29) = P(ages 15-19|learning piano)
C.
P(ages 15-19|learning piano) ≠ P(ages 15-19)
D.
P(learning piano|ages 20-24) = P(learning piano)

Answers

C P(ages 15-19)| learning piano)=/P(ages 15-19)

P(ages 15-19|learning piano) = P(playing piano|ages 25-29) so option (B) must be correct.

What is a frequency table?

A frequency table is a list of objects with the frequency of each item shown in the table.

The quantity of times that an event or value occurs is its frequency.

In other words, a frequency table is a table in which we have some data and their frequency.

Given the problem has been attached below,

It is clear that

Number of playing piano in the age of 25 - 29 = Number of playing piano in the age of 15 - 19

Hence it should be the correct answer.

To learn more about the frequency table

brainly.com/question/12576014

#SPJ2

I need help on this please

Answers

Answer:

-22

Step-by-step explanation:

each mark decreases by three, two marks down from 16 would be 16+3+3; which equals 22, and it has to be negative

hope this helped!

I think it’s either 19


But I’m not 100% sure, but why I think this is because 10…..16
So between those 2 numbers is 13
That means that it adds by 3
Which maybe 16+3=19
sorry tho I’m not that sure but I think it is ?

Identify coordinate point C.

(1, 5)
(6, 7)
(7, 3)
(0, 2)

Answers

Answer: (6,7)

Step-by-step explanation:

Answer:

(7,6)

Step-by-step explanation:

look above as your axis x it's 7, and then down is axis y is 6.

How many solutions are there for the system of nonlinear equations represented by this graph?

Answers

The total solution for the system of nonlinear equations represented by this graph is 2 solutions

Graphs and Functions

Quadratic function have a leading degree of 2. The graph of a quadratic function is parabolic in nature.

Since the given graph consists of a parabola, hence the total solution for the system of nonlinear equations represented by this graph is 2 solutions

Learn more on graphs here: https://brainly.com/question/25020119

#SPJ1

Pleaseeeee helpppppp
Please help me evaluate this in terms of sin/cos/sec etc. (trigonometric form)

tan2θ-(1-tan2θ)=?

Answers

The evaluation is (2sin2∅-cos2∅)sec2∅.

What are trigonometric functions?

Trigonometric functions are functions used to relate the sides of a triangle with its angles.

Analysis:

2tan2∅ -(1- tan2∅)

2tan2∅ - 1 + tan2∅

3tan2∅ - 1

3([tex]\frac{sin2\alpha }{cos2\alpha }[/tex]) - 1

(3sin2∅/cos2∅) - 1

(3sin2∅ - cos2∅)/cos2∅

but 1/cos2∅ = sec2∅

(3sin2∅ - cos2∅)/sec2∅

Learn more about trigonometric functions: brainly.com/question/24349828

#SPJ1

the hcf of 12x^2-4xy+15x-5y​

Answers

Answer:

-1

Step-by-step explanation:

We have 2 letters, x and y. what letter is in all of them? none of them. that means the HCF can't contain a letter. let's take away the letters, we have 12, -4, 15, -5. Since -5 is a prime number. the answer is -1

help me pls I need to get my grade up before July 11th so help ASAP​

Answers

Second option:
-7x^2+4x+2

Use the digits 1-9 without repeating, to create two prisms with the same volume

Answers

Two prisms with the same volume are rectangular prisms of the dimensions  1 by 4 by 9 and 2 by 3 by 6

How to create the prisms?

To do this, we start by determining the type of prism to create.

Assume that we want to create a rectangular prism.

The volume of a rectangular prism is:

Volume = Length * Width * Height

Using the digits 1 - 9, we have:

Prism 1

Length = 1

Width = 4

Height = 9

The volume is

Volume = 1 * 4 * 9 = 36

This means that the second prism must have a volume of 36.

Using the digits 1 - 9, we have:

Prism 2

Length = 2

Width = 3

Height = 6

The volume is

Volume = 2 * 3 * 6 = 36

Notice that the digits are not repeated.

Hence, two prisms with the same volume are rectangular prisms of the dimensions  1 by 4 by 9 and 2 by 3 by 6

Read more about volumes at:

https://brainly.com/question/1972490

#SPJ1

Which function is increasing and has a domain of (1, )?
A. -log(x − 2) + 1 B. -log(x − 1) + 2 C. log(x − 1) + 2 D. log(x − 2) + 1

Answers

Answer:

B . it was right when I picked it


A piece of card, 1200 cm² in area, will make a tube 13 cm long. How long is a similar
tube made from a similar piece of card with an area of 500 cm³?

Answers

The length of the similar tube will be 5041 cm.

What is the area?

The space occupied by any two-dimensional figure in a plane is called the area. The space occupied by the circle in a two-dimensional plane is called the area of the circle.

Given that:-

A piece of card, 1200 cm² in area, will make a tube 13 cm long. How long is a similar?Tube made from a similar piece of card with an area of 500square centimetres.

The radius of the first tube will be calculated as:-

1200 = 2πr ( 13 )

r = 12 / 2π x 113

r = 14.7 cm

Now the length of the second tube will be:-

500 = 2π x 14.7 x L

L = 500 / 2π x 14.7

L = 5.41 cm.

Therefore the length of a similar tube will be 5041 cm.

To know more about an area follow

https://brainly.com/question/25292087

#SPJ1

Mr. Addison is building a sandbox shaped like a rectangular prism. The sandbox is 9ft long, 5ft wide, and 2.5 ft deep. How many cubic ft of sand will the sandbox hold?

Answers

Answer.= 112.5 cu ft

Volume is what you are looking for
Volume is L x W x H
9x5x2.5 = 112.5 cu ft
Other Questions
Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain. A chemical reaction can be reversed if?The energy of the reactants exceeds the activation energy threshold.The energy of the products exceeds the activation energy threshold.The energy of the reactants is less than the activation energy threshold.The energy of the products is less than the activation energy threshold. Miguel Rodriguez borrowed $300 from his brother Julio to pay for books and tuition. He agreed to pay Julio in 6 months with simple annual interest at 6.9% Someone please help fast!Simplify: in the picture Choose the correct verb in subjunctive and complete the following sentences.Espero que sean/conozcan las pirmides de Egipto What is f(x) + f(x) + f(x)? 3f(x)3f(x) = 3xEvaluate 3f(2) = . Which topic below would be a good one for a demonstration?steps for safety during an earthquakewhy frogs sing after it rainswhat to look for in a petwhere Canada is on a map (3x-2)(3x-2)(3x-2)(2x+1) Read the excerpt from Brown v. Board of Education.Therefore, we hold that the plaintiffs and others similarly situated for whom the actions have been broughtare, by reason of the segregation complained of, deprived of the equal protection of the laws guaranteed bythe Fourteenth Amendment.Why does the Supreme Court conclude that the plaintiffs have been denied their rights?O The plaintiffs' schools have neglected their responsibilities.O The Fourteenth Amendment fails to reference education.Segregation is inherently unequal and unfair.The plaintiffs' children have endured racial stereotyping. Tengo que hacer una historia de un mundo distopico ayuda