andy offers to sell barb ten computers for her office. barb sends a rejection first, then later changes her mind and sends an acceptance. whether they have a contract is determined by
a. Barb's rejection.
b. Barb's acceptance.
c. whether Barb's rejection or acceptance is received first.
d. mailbox rule.

Answers

Answer 1

Whether they have a contract is determined by  whether Barb's rejection or acceptance is received first. Hence, Option C is correct.

What is meant by rejection?

the act of rejecting someone or something: Our plans were rejected by the government, which is a setback for us.

Social rejection  exacerbates a variety of emotions, including anger, anxiety, despair, envy, and grief. It impairs performance on demanding intellectual tasks, DeWall claims in a recent review, and can also result in hostility and poor impulse control.

Thus, option C is correct.

For more information about rejection, click here:

https://brainly.com/question/15577974

#SPJ1


Related Questions

which significant event triggered the rapid and continuing growth in the demand for higher education in texas?

Answers

The end of World War II triggered the rapid and continuing growth in the demand for higher education in Texas.

In Texas, higher education is provided by a number of public and private institutions. The Texas Higher Education Coordinating Board is the state agency responsible for coordinating higher education in Texas.

The Coordinating Board oversees the state's public university system, which includes nine universities and two health-related institutions. The Board is committed to ensuring that all Texans have access to the resources and opportunities they need to succeed in higher education

To know more about education, click here.

https://brainly.com/question/1602018

#SPJ4

which of the following are true of translating stockholders' equity? multiple select question. paid-in capital amounts are not revalued. retained earnings is translated at the current exchange rate. each component of stockholders' equity is translated at the current exchange rate. accumulated other comprehensive income will balance the translated balance sheet.

Answers

The following are true of translating stockholders' equity : accumulated other comprehensive income will balance the translated balance sheet.

Shareholders, or sday-to-dayckholders, are the proprietors of a organization's notable stocks, which represents a residual portion of the company's property and profits as well as a percent of the organization's voting electricity.

A shareholder of a corporation is an individual or legal entity that is registered by means of the organisation because the legal owner of shares of the proportion capital of a public or private business enterprise. Shareholders can be daily participants of a employer.

Shareholders are the owners of the employer. they have got ownership rights within the shares of corporate stock. The position of the shareholder inside the employer is confined, but, as they have got neither the proper nor the duty daily manage the business of the company.

Learn more about stockholders here : https://brainly.com/question/14032844

#SPJ4

a parcel of vacant land, which is 80 feet wide on the street side of the property and 200 feet deep, is sold for $200 per front foot. how much money would an affiliated broker receive for her 60% share in the 10% commission?

Answers

Money would an affiliated broker receive for her 60% share in the 10% commission is  $1,920,000

How to calculate the area of the vacant land ?

Area = (80 ft)(200 ft)

Area = 16000 ft^2

Then, multiply the calculated area with the given price per ft^2.

Total price = ($2000/ft^2)(16,000 ft^2)

Total price = $32,000,000

The 10% commission of selling the land is equal to $3,200,000.

The money that the broker will receive will be 60% of the commission.

= (0.6)($3,200,000)

= $1,920,000

Not all parcels of land are precisely triangular, rectangular, or square in shape. As a result, it can be challenging to estimate the extent of this type of land because its shape is not constant. Vacant land is defined as any land on the property that is not also used as the foundation for a construction. No unoccupied land tax is assessed when a building is constructed on the property and its plinth area exceeds 25% of the plot's area.

To learn more about area of vacant refer to:

https://brainly.com/question/4196184

#SPJ4

refer to scenario 20-3. this negative income tax would guarantee what minimum level of income to every family? a. $5,000 b. $10,000 c. $15,000 d. $50,000

Answers

$15,000 We can see that $15000 is reduced from 1/5th of income to capital.

What is capital?Capital is a broad term that can describe anything that confers value or benefit to its owners, such as a factory and its machinery, intellectual property like patents, or the financial assets of a business or an individual.While money itself may be construed as capital, capital is more often associated with cash that is being put to work for productive or investment purposes. In general, capital is a critical component of running a business from day to day and financing its future growth.When budgeting, businesses of all kinds typically focus on three types of capital: working capital, equity capital, and debt capital. A business in the financial industry identifies trading capital as a fourth component.

To learn more about working capital refer to:

https://brainly.com/question/28504087

#SPJ4

A budgeting process that involves the input and negotiation of several layers of management describes the management philosophy of __________ budgeting.

Answers

A budgeting procedure that includes the enter and negotiation of numerous layers of control describes the control philosophy of Participative budgeting.

The required details for Participative budgeting in given paragraph

Participative budgeting is a procedure below which humans impacted with the aid of using a price range are actively concerned within side the price range advent procedure. This method offers lower-stage managers a more feel of possession within side the ensuing price range. A basically participative price range does now no longer take high-stage strategic issues into account, so control desires to offer personnel with hints concerning the general path of the business enterprise and the way their man or woman departments suit into it. When participative budgeting is used for the duration of an business enterprise, the initial budgets paintings their manner up via the company hierarchy, being reviewed and probably changed with the aid of using mid-stage managers alongside the manner.

Advantages of Participative Budgeting

This bottom-up method to budgeting has a tendency to create budgets which might be greater workable than are top-down budgets which might be imposed on a business enterprise with the aid of using senior control, with tons much less worker participation.

To know about Participative budgeting click here

https://brainly.com/question/29304721

#SPJ4

which two rules pertain to the general daily activities of employees in a call center environment? (choose two.)

Answers

The following two rules apply to the general daily activities of call center employees: The technician should ensure that all customers are treated equally and If the technician is going to be late for a follow-up appointment, the technician should notify the customer.

A call center is a centralized department that handles both inbound and outbound calls from existing and prospective customers. Call centers are either housed within an organization or outsourced to another company that specializes in call handling.

Customer questions and concerns about goods or services are handled by a call center representative or agent. They are in charge of offering assistance throughout to address queries or concerns raised by customers.

To know more about call center, click here.

https://brainly.com/question/29156092

#SPJ4

firm a is a us firm that operates in france, italy, belgium, netherlands, austria and spain. firm b is also a us firm that operates in india, china, brazil, mexico, germany, and australia. assume that both firms are in the same industry and that their financial characteristics (size, leverage, profitability etc.) are not significantly different. which of the two companies do you believe will be more likely to experience a more significant operating exposure to currency risk? what methods of operating exposure management can you recommend as better suited for firm a and for firm b?

Answers

Firm A is more likely to experience a more significant operating exposure to currency risk due to its greater geographic diversity.

What is currency risk?

Currency risk, also known as exchange rate risk, is the risk associated with fluctuations in the value of a foreign exchange rate. It is the risk that changes in the exchange rate of one currency against another will reduce the value of an investment. Currency risk affects both businesses and investors, and can lead to significant financial losses.

Firm A is exposed to multiple currencies across different countries, increasing the risk of volatility in each currency. Firm B is only exposed to a few currencies, which limits the magnitude of the risk.

For Firm A, the best methods to manage operating exposure to currency risk include hedging the foreign exchange rate, utilizing currency options, and diversifying foreign investments. Hedging the foreign exchange rate will allow the company to lock in an exchange rate and protect against losses due to currency volatility. Currency options allow the company to limit their risk by allowing them to purchase an option to buy or sell a currency at a specific rate, thus allowing them to set a limit on their loss or gain. Finally, diversifying foreign investments will help spread out the risk across different countries, reducing the risk of large losses due to currency fluctuations.

For Firm B, the best methods to manage operating exposure to currency risk include hedging the foreign exchange rate, utilizing currency futures, and diversifying foreign investments. Hedging the foreign exchange rate will allow the company to lock in an exchange rate and protect against losses due to currency volatility. Currency futures allow the company to limit their risk by allowing them to purchase a contract to buy or sell a currency at a specific rate, thus allowing them to set a limit on their loss or gain. Finally, diversifying foreign investments will help spread out the risk across different countries, reducing the risk of large losses due to currency fluctuations.

To learn more about currency risk
https://brainly.com/question/29358082
#SPJ4

A riskier bond usually comes from a corporation that has a ______ (low/high) credit rating.

Answers

Investing in corporate bonds is riskier than in government bonds have high credit rating. Corporate bonds are debt securities that a firm issues and sells to investors.

What is Riskier bond?

They provide greater rates of return since they are riskier bond than treasury bonds. The representative bank sells them. There are three different kinds of corporate bonds: high-yield or junk bonds, which are issued by corporations with a high risk of default.

Though officially stocks, preferred stocks behave more like bonds. They provide you with a set dividend on a regular basis. In the event of bankruptcy, they are somewhat less risky than stocks. Holders get payment after bondholders but before shareholders of ordinary stock. When a company needs financing, they issue bonds, which have higher interest yields than government bonds. The secondary market is where these bonds are exchanged.

To know more about Riskier bond, visit:

https://brainly.com/question/29469909

#SPJ1

should the corporations work together or compete for labor?

Answers

Answer:

Opinion based.

Explanation:

Corporations may choose to compete for labor since in not doing so may result with economic loss which is not good for the corporation. There may be benefits from working together such as a corporation growth but more income results in many wanting more money or unfair wages within the both corporation towards each other.

Jason Hansen has invested $600,000 in a privately held family corporation. The corporation does not do well and must declare bankruptcy. What amount does Hansen stand to lose?A) Up to his total investment of $600,000.B) Zero.C) The $600,000 plus any personal assets the creditors demand.D) $400,000.

Answers

The charter of the corporation is a legally binding document that must be delivered towards the Secretary of State. when the corporation is incorporated.

What are examples and demand?

Key Learnings. According to the economic principle known as the law of demand, meeting customer expectations for a good increases when prices are low and decreases when prices are high. When consumers rush to purchase goods at steep discounts during Black Friday sales, the law of demand is in effect.

Why is there a demand?

Demand: What Is It? Demand describes the customer's desire and readiness to purchase a good or service at a specific time or over an extended period of time. Additionally, consumers must be able to afford the items they want or require based on their budgeted disposable income.

To know more about demand visit:

https://brainly.com/question/29761926

#SPJ4

Roles of custom officials in a bonded warehouse​

Answers

HOPE IT HELPS!!!!!!!

MARK AS BRAINLIEST

which element of site selection is most likely to be more important to a service-oriented business than to a goods-oriented business?

Answers

Distance to customers  is most likely to be more important to a service-oriented business than to a goods-oriented business.

What are customers?

Customers and consumers may or may not be the same thing, but they are two different things. Consumers use the products that customers buy. An ultimate client could also be a consumer, but they might also have bought things for someone else to consume. A middle customer is not at all a consumer. The situation is somewhat complicated because the ultimate consumers of so-called industrial goods and services (which are organizations like governments, manufacturers, educational, and healthcare institutions) either consume the goods and services they purchase outright or use them to create other finished goods. They are more frequently referred to as industrial customers or business-to-business customers instead.

To learn more about customers , visit:

brainly.com/question/2040044

#SPJ4

In The Iowa Car Crop, Steven Landsburg argues that importing cars from Japan and exporting wheat from Iowa is analogous to...
A) importing wheat.
B) exporting cars.
C) growing cars in Iowa.
D) growing wheat in Japan.

Answers

In The Iowa Car Crop, Steven Landsburg argues that the importing of cars from Japan and exporting wheat from Iowa is analogous to growing cars in Iowa. Thus option (c) is the answer.

What role does comparative advantage play in global trade?

According to the principle of comparative advantage, countries would engage in international trade while exporting the goods in which they have a comparative advantage. Everyone and every country cannot have a comparative advantage in every good.

In an economic model, if agents can produce a specific good at a lower relative opportunity cost than their rivals, they will have a comparative advantage over those rivals in that particular good's production. When referring to international trade, the term "comparative advantage" describes the products that one nation can create more quickly or inexpensively than another. As a result, someone else or some other country will be able to create some things at a lower opportunity cost.

To learn more about comparative advantage, visit:

https://brainly.com/question/13221821

#SPJ1

for a polluting steel company, a government action to most likely achieve an optimal or efficient outcome would produce what effect on the market equilibrium price and output?

Answers

People will compete for the few available goods and raise prices if there is a surplus of output sought over the amount of output created.

Why does output increase when price increases?In most cases, rising prices are a sign that businesses need to increase production in order to satisfy a higher level of total demand. Consumers compete for the available commodities and pay higher prices as a result of the rising demand and constant supply. In order to sell more products, this dynamic forces businesses to boost output.The Law of Demand is what economists refer to as. The demand for a product decreases as the price rises (but demand itself stays the same). The quantity demanded rises if the price drops. The surplus supply at the starting price results from the decline in demand. a. If there is too much of a good on the market, the price will drop, and as it does, producers will be less motivated to create it.

To Learn more About  amount of output refer to:

https://brainly.com/question/26056747

#SPJ4

In the context of credit ratings, what is character?
O
something of value used to secure a loan
O
a numerical estimate of your creditworthiness
O your ability to repay a loan
O your prior record of paying your bills and paying off your debts

Answers

Answer:

a numerical estimate of your creditworthiness

Answer: 1. a loan from one entity electronically matched to another entity without a financial institution in the middle

2. a payday loan

3. an unsecured installment loan

4. It decreases your monthly expenses, giving you more money to spend on other things.

5. Determine or estimate the current value of everything you own.

6. Their ability to repay a loan

7. your prior record of paying your bills and paying off your debts

8. your age and gender

9. You can request one online or over the phone.

10. He should contact the credit bureau that issued the credit report, the companies that issued the seven fraudulent cards, his local police, and the federal government at identitytheft.gov.

11. -the lender that provided the incorrect information

-the credit bureau that prepared the report

12. right away

13. She won a $20 billion settlement for California homeowners whose homes were inappropriately foreclosed on.

14. The longer the term, the more you will pay in interest.

15. It will cost you less money overall.

16. A store credit card generally comes with a higher interest rate.

17. You will save money if you pay the balance off quickly.

18. -Clarifying the confusing language found on credit card applications.

-Forcing lending companies to disclose interest rates and hidden fees.

19. It banned credit card companies from raising interest rates after missed payments.

20. -a fixed annual charge for the use of a credit card

-a charge if the minimum payment is not paid by the due date

21. paying off the balance before interest can accrue

22. $30

23. Determine which card has the higher interest rate and pay the extra money to that card first.

Explanation: All these answers are correct!

Select the examples of national security employers. check all that apply.
a. the army
b. the air force
c. the irs
d. the us embassy
e. the coast guard
f. the state legislature
g. the navy
h. the marine corps

Answers

The examples of national security employers includes:

a. the armyb. the air forcee. the coast guardg. the navyh. the marine corps.

Who are national security employers?

Basically, a national security, also known as a national defence, refers to the security and defence of a sovereign state including its citizens, economy, and institutions, which is regarded as a duty of government. It also means the ability of a country's government to protect its citizens, economy and other institutions.

In this context, the army, air force, coast guard, navy and marine corps are defence department that employs people to strengthen the national security.

Read more about national security

brainly.com/question/1083892

#SPJ1

if a loan isn‘t repaid, the__ of the borrower—used as security for the debt—could be sold by the lender.

Answers

If a loan is not repaid, the collateral of the borrower, used as security for the debt, could be sold by the lender.

In financial terms, collateral refers to a valuable asset that a borrower pledges as security for a loan. It means that collateral is an element of value pledged to secure a loan. Collateral offers a way to reduce the risk for lenders. In case a borrower becomes a defaulter on the loan, the lender can seize the collateral and sell it to recoup their losses. A loan amount that is secured by collateral offers a lower interest rate than an unsecured loan. Car loans and mortgages are two types of collateralized loans.

You can learn more about collateral at

https://brainly.com/question/11665626

#SPJ4

1. What is the savings in a bank referred to as? (1 point)
A. A pile of money under your mattress
B. A real estate property
C. A luxury car
D. An interest bearing savings account

Answers

D an interest bearing savings account

cynthia needs to share a financial snapshot of her company, including its current worth. which quickbooks report would be most useful?

Answers

QuickBooks balance sheet would be most useful to Cynthia.

What is a balance sheet account in QuickBooks?

You can simply run current balance sheet reports whenever you need them thanks to the way QuickBooks organizes your accounting data. For your accountant, print the required reports or save them as PDF files. A balance sheet report provides you with a financial overview of your business as of a particular date.

By deducting all of the money your firm owes (liabilities) from everything it has (assets), it determines how much your business is worth (your business's equity): Equity is equal to the difference between assets and liabilities. All of your transactions, both those you've reviewed and those you haven't, have an impact on your QuickBooks balance. While only the transactions recorded in the register are used to calculate the bank balance.

To learn more about QuickBooks balance sheet, visit:

https://brainly.com/question/29621784

#SPJ1

our 50 states of burgers list will ensure a good hearty meal is part of your winter wander. where in wisconsin do we send you for a burger served with a side of cheese curds?

Answers

The appropriate response is The Dotty Dumpling's Dowry.It will guarantee that your winter hike includes a satisfying, hearty supper.

Why is food referred to as hearty?

An adjective like "hearty" can be used in many different contexts. It can refer to: (1) someone who is warm and enthusiastic; (2) someone who is robust and healthy; (3) someone who eats; (4) someone who needs or demands a lot of food.

How do you define a hearty salad?

Enter filling salads.

This type of dinner is one that I define as being primarily vegetable-forward with just the right amount of highly desired components (such as thoroughly roasted squash, cheesy breadcrumbs, and bacon crisps) to make each bite feel like opening a gift.

To know more about hearty visit:

https://brainly.com/question/29664342

#SPJ4

a quality perspective that focuses on whether or not a product was made or a service was performed as intended is the:

Answers

A quality perspective that focuses on whether or not a product was made or a service was performed as intended is the Conformance perspective. It is one of the Eight dimensions of quality.

What is the Eight dimensions of quality?

David A. Garvin, formerly the C. Roland Christensen Professor of Business Administration at Harvard Business School, identified eight aspects of quality that can be utilized strategically to examine the qualities of a product.

Performance, features, dependability, compliance, durability, serviceability, aesthetics, and perceived quality are the eight important characteristics or categories of quality that Garvin suggests might act as a framework for strategic analysis.

The degree to which a product complies with standards in terms of its design and functionality is shown by the conformance perspective or dimension.

Therefore, the conformance dimension or perspective focuses on whether or not a product was made or a service was performed as intended.

To learn more about the Eight dimensions of quality, click here:

https://brainly.com/question/15690006

#SPJ1

multiple choice question a company has an unfavorable direct materials quantity variance. a possible reason for this variance is that: multiple choice question. the purchasing department purchased materials at a cost less than expected the production department used more materials than expected the production department used fewer materials than expected the purchasing department purchased materials at a cost more than expected

Answers

A possible reason for this variance is that production department used more materials than expected.

What is production?

By using the initial inputs productively, the manufacturing process and outcome are produced directly. Land, labor, and capital are thought of as the three basic production components, often known as primary producer commodities or services. In the output process, neither the primary inputs nor the finished product are considerably changed. Materials and energy, which are byproducts of land, labor, and capital, are categorized as secondary elements in classical economics. A further look reveals that primary determinants include all of the resources at play, including land, which includes natural resources above and below the soil. Labor and human capital, however, differ from one another. Technology and entrepreneurship are sometimes regarded as evolved elements in production in addition to the common factors of production in various economic schools of thinking.

To learn more about production, visit:

https://brainly.com/question/14311206

#SPJ4

bijoux company has sales of $40,000, beginning inventory of $5,000, purchases of $25,000, and ending inventory of $7,000. the cost of goods sold is

Answers

The cost of go-ods sold is $23,000.

Solution -

Given : Sales - $40,000

Beginning inventory - $5,000

Purchases - $25,000

Ending inventory - $7,000

To find - Cost of goods sold.

Costs of goods sold = beginning inventory + purchases − ending inventory.

Costs of goods sold = $5,000 + $25,000 - $7,000

= $23,000

Hence, Costs of goods sold is $23,000.

The cost of go-ods sold (COGS) is the sum of all direct cost assoc-iated with making a product. It app-ears on an income state-ment and typically incl-udes money spent on raw mate-rials and labor. It does not inc-lude cost associated with market-ing, sales or distri-bution.

To know more about costs of goods sold click below:

brainly.com/question/13499038

#SPJ4

An estimate of what revenue and costs should have been, based on the actual level of activity is shown on a:_______.

Answers

An estimate of what revenue and costs should have been, based on the actual level of activity is shown on a flexible budget.

What is a flexible budget?

A flexible budget is one that can change depending on the activity or volume levels of a business. A flexible budget continuously varies with a company's cost variations, in contrast to a static budget, which remains fixed from the numbers decided upon when the budget is created. With a flexible budget, it is simple to demonstrate that even if expenses for a given month may have exceeded projections, sales were higher than expected, thereby justifying the rise. To better predict future expenditures, you can also review the notes and monthly modifications. When income or other activity numbers are still being completed, flexible budgeting can be utilised to more easily alter a budget. Under this strategy, managers consent to all fixed expenses.

To learn more about flexible budget click,

https://brainly.com/question/25353134

#SPJ4

national insurance company has 300,000 shares authorized, 195,000 shares issued, and 22,000 shares of treasury stock. the number of shares outstanding is:

Answers

A company may choose to buy back outstanding shares for a number of reasons. Repurchasing outstanding shares can help a business reduce its cost of capital.

What does outstanding shares mean?Shares outstanding refer to a company's stock currently held by all its shareholders, including share blocks held by institutional investors and restricted shares owned by the company's officers and insiders. Outstanding shares are shown on a company's balance sheet under the heading “Capital Stock.”Based on the given information, The number of shares outstanding is 173,000 shares.Shares outstanding describe the equity that a firm currently possesses, including share units held by investment firms and limited shares owned by insiders and officers.Outstanding Shares– Key Differences. Issued shares are the total shares issued by the Company. Whereas outstanding shares are the shares with the shareholders, i.e., it does not include the shares repurchased by the Company. Thus, subtracting treasury shares from the issued shares will give outstanding shares.

To calculate the Number of shares outstanding based on the given information

Shares issued = 195,000

Shares of treasury stock = 22,000

Number of shares outstanding=195,000-22,000

Number of shares outstanding = 173,000shares

Therefore, the number of shares outstanding is 173,000 shares.

To learn more about shares outstanding refer to:

brainly.com/question/25630152

#SPJ4

what is a plan that breaks down a project’s goals into the many deliverables required to achieve it?

Answers

Answer: A project is visually, hierarchically, and deliverable-focused disassembled using a work breakdown structure (WBS). It is a useful diagram for project managers since it enables them to deconstruct the scope of their projects and see all the tasks necessary to finish them.

Explanation: What objectives is a work breakdown structure, or WBS, supposed to aid in?

A WBS's objective is to reduce the size and complexity of a huge project. By breaking it down into smaller pieces, work can be completed concurrently by various team members, improving team productivity and simplifying project administration.

Which document should include a list of all the project deliverables and a description of each one?

All the information needed to produce the project deliverables is contained in a written document known as the project scope statement. It aids the project team in staying focused and on task and is more thorough than a statement of work.

WBS: What Does It Mean?

breakdown structure for the work

Work breakdown structure, or WBS, is an acronym for project management. Here is a

To know more about Work Breakdown Structure visit;

https://brainly.in/question/2250735?

#SPJ4

channel conflict occurred when american airlines decided to terminate its relationship with orbitz and expedia, two online ticketing and travel sites, and sell directly through aa direct connect. this is an example of multiple choice corporate conflict. forward integration conflict. horizontal conflict. lateral conflict. disintermediation.

Answers

When American Airlines chose to end its partnership with Orbitz and Expedia, two online ticketing and travel sites, and sell directly through AA Direct Connect, there was a channel conflict. Disintermediation is demonstrated here.

Give a definition and an example of disintermediation.

Disintermediation is the process of removing the financial intermediary from a transaction. It can let a customer to order from a manufacturer directly as opposed to going through a distributor or store. Additionally, it can enable a business to place a direct order with a manufacturer.

Disintermediation is the process of eliminating middlemen from the supply chain so that products can be sold directly to customers. For instance, if brokers were eliminated as a middleman so that a company could communicate with and advertise its shares directly to its potential buyers, disintermediation would take place.

Learn more about disintermediation: https://brainly.com/question/29218035

#SPJ4

which has greater elasticity: a supply curve that goes through the origin with slope of 1 or a supply curve that goes through the origin with slope of 3?

Answers

A deliver curve that is going via the beginning with slope of one or a deliver curve that is going via the beginning with slope of 3: They each have the identical elasticity.

The required details for Elasticity in given paragraph

Elasticity measures the proportion alternate of 1 monetary variable in reaction to a percent alternate in another. If the fee elasticity of the call for of some thing is -2, a 10% boom in fee reasons the call for amount to fall through 20%. Elasticity is an essential idea inner classical monetary principle, and permits within side the expertise of numerous monetary concepts, along with the prevalence of oblique taxation, marginal concepts regarding the principle of the firm, distribution of wealth, and different varieties of goods regarding the principle of client choice. An expertise of elasticity is likewise essential whilst discussing welfare distribution, in particular client surplus, manufacturer surplus, or authorities surplus.

Elasticity is gift all through many monetary theories, with the idea of elasticity performing in numerous major indicators. These include fee elasticity of call for, fee elasticity of deliver, profits elasticity of call for, elasticity of substitution between elements of production, cross-fee elasticity of call for, and elasticity of intertemporal substitution.

To know about Elasticity click here

https://brainly.com/question/1048608

#SPJ4

founded by martha graham and taken over by ohad naharin, which company is respected for its imaginative and risk-taking approach to dance?

Answers

Batsheva is founded by Martha Graham and brought over through ohad Bahrain, which enterprise is reputable for its imaginative and chance-taking approach to bop.

Martha Graham (may additionally be eleven, 1894 – April 1, 1991) changed into an American present-day dancer and choreographer. Her style, the Graham method, reshaped American dance and is still taught internationally.

Graham danced and taught for over seventy years. She changed into the first dancer to carry out at the White House, journey abroad as a cultural ambassador, and receive the very best civilian award of the united states: the Presidential Medal of Freedom with distinction. In her lifetime she received honors ranging from the key to the city of Paris to Japan's Imperial Order of the treasured Crown. She stated, in the 1994 documentary The Dancer discovered: "I've spent all my existence with dance and being a dancer.

It is permitting existence to use you in a totally severe manner. now and again it isn't high-quality. from time to time it is fearful. but although it is inevitable." based in 1926 (the identical year as Graham's expert dance organization), Martha Graham college is the oldest college of dance in the u.s.a.

To learn more about Martha Graham visit here:

brainly.com/question/28695998?

#SPJ4

what can the organization use the porter five forces analysis to promote competitiveness in their industry?

Answers

Porter's 5 forces make up a study model of the competitive structure of an industry in which the following are analysed:

The bargaining power of customersThe bargaining power of suppliersThe threat from substitute productsThe threat from represent incoming products

Porter's 5 forces

These five elements are analyzed separately but interconnected, since each of them affects the organization's level of competition. By analyzing the threats of these competitive forces, we can determine our position in the market and understand why we have the current market share.

For more about Porter's 5 forces here https://brainly.com/question/12587672

#SPJ4

Other Questions
Which of the following is a benefit of knowing and using organizational skills?Reducing stressIncreasing how long tasks takeReducing efficiencyIncreasing the number of steps in a task micro tek inc. is considering an investment in new equipment that will be used to manufacture a smartphone. the phone is expected to generate additional annual sales of 4,000 units at $450 per unit. the equipment has a cost of $940,000, residual value of $20,000, and an eight-year life. the equipment can only be used to manufacture the phone. the cost to manufacture the phone follows: 61. at 0500 hours, you respond to the home of a 76 year old man complaining of chest pain. upon arrival the patient states that he had been sleeping in the recliner all night due to indigestion, when the pain woke him up. he also tells you he has taken two nitroglycerin tablets. his vital signs are as follows: respirations, 16 breaths/min; pulse, 98 beats/min; blood pressure, 92/76 mm hg. he is still complaining of chest pain. what actions should you take to intervene. The sum of two numbers is 35 if one number is 4 times the second number find the numbers. Write a formal message of condolence using the following Rita Karki - 46 Years - died of cance helpbul, sociable - a leader of the community - active- miss her very The Double V Campaign sought to fight for democracy in Europe and toend racism in the United States.O create a new League of Nations.revert back to the policy of neutrality.O promote a communist government. when the nurse interviews a client with internal hemorrhoids, what would the nurse expect the client to report? find the volumes of the solid(s) Describe how high-energy electrons are ultimately responsible for driving the reactions of photosynthesis. Plot the image of point A under a dilation about point P with a scale factor of 3. Below is a list of inventions that came out during the Industrial Revolution, describe the impactof each oneIndoor plumbingToiletsToilet paper Electricity Cars Trains Radio Steam Engine Dynamite Cameras I have a triangle with c as hypotenuse, b as opposite, and nothing for adjacent. Bottom left corner is 62 degrees and the right bottom corner is 90 degrees. Round answer to nearest 16th of an inch SolvingThe product of 5 and the differencebetween a number and 7 is 75. What isthe number? a pregnant woman in the second trimester of pregnancy complains of constipation and describes the home care measures she is taking to relieve the problem. which would the nurse determine is a harmful measure in preventing constipation? Which statement accurately describes how toproperly use a semicolon to join independentclauses? An advantage of the balanced scorecard framework is the ability to automate the flow of information on __________, so that executives are kept fully informed about business performance. original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ? The authors most likely use the examples in lines 1-10 of the passage ("Piaget's...knowledge") to highlight thePiaget's theory of cognitive development is acomprehensive theory about the nature anddevelopment of human intelligence. It was firstdeveloped by the Swiss clinical psychologist JeanPiaget, who lived from 1896 to 1980. It is primarilyknown as a theory of the stages of humandevelopment. Beyond this primary purpose, it alscdeals with the nature of knowledge itself and howhumans come gradually to acquire, construct, and use knowledge. Please help me solve! a dam holds back the water in a lake. if the dam has a small hole 1.4 meters below the surface of the lake, at what speed does water exit the hole?