Answer:
D
Explanation:
I hope this is correct and have a great day
Which of these can a wave carry from one place to another?
energy
matter
particles
water
Answer:
energy
Explanation:
hope its is correct!!
Find the EXACT area of the shaded. The square has a side length of 24 meters.
Answer:
Explanation:
If the entire square is shaded and that 24m being the measurement of just one side just multiply 24 by 24 which is 576[tex]m^{2}[/tex]
If you are saying that 24 is the length of all of the sides combined just divide 24 by 4 to get one side and square it. 6 times 6 and you get 36[tex]m^{2}[/tex]
In what ways are active transport and passive transport similar?
Answer: While active transport requires energy and work, passive transport does not.
Explanation:
HELP ME WITH THIS PLEASE!!!!!!!
Answer:
c
Explanation:
Answer:
Primary consumer.
Explanation:
Ok, so a producer is stuff like grass. Then you've got decomposers, which are maggots and vultures and animals like that (ew). Our primary consumer is the bird, then you've got the snake which eats the bird, and then there's the alpha predator, the hawk, which can eat both the snake and the bird. We call the alpha predator the tertiary consumer.
Do you get it now?
Chromosome pair 23 are the sex chromosomes and are responsible for determining the gender of a human. The large chromosome is an X chromosome, and the small chromosome is the Y chromosome. If there are two X’s, then the individual is a female. If there is an X and Y, then the individual is a male.
Answer:
This is true.
Explanation:
More commonly, an X chromosome will die and get replaced by a Y chromosome (all humans start off as females). When this occurs, the substitute Y chromosome causes changes in the zygote to occur; they begin developing male genitalia (i.e. penises, testicles, prostates, etc.).
Which is a correct statement about mutations?
A. Mutations are always bad.
B. Mutations ensure alleles never change.
C. Mutations increase variety in a population.
D. Mutations decrease variety in the population,
why is cell division important for one-celled organisms and multi-celled organisms
Answer:
so they can reproduce
Explanation:
Many different types of mutations can occur within the body. An individual experiences a mutation that changes a base in a mRNA strand, but during translation the mRNA strand still creates the same protein. Which type of mutation is responsible for the change in the mRNA base?
Answer:
silent mutation
Explanation:
Answer:
The answer is silent mutation
Explanation:
Good luck!!!
Explain why Hurricane Harvey traveled from the east (Africa) towards the west (Florida) when our weather in Wisconsin starts in the west and travels east?
PLEASE HELP!
Answer:
Due presence of Sahara desert that is responsible for the formation of this hurricane and its movement towards Florida.
Explanation:
Hurricane Harvey traveled from the Africa towards the Florida because these hurricane formed at the African region due to the presence of Sahara desert. The hot and dry wind of Sahara desert meets with the cool, moist air from the south produces these hurricane which then moves from the Africa to the west side where Florida is located so that's why Hurricane Harvey traveled from Africa towards the Florida.
what is cell differentiation dependent on
many things
the number of chromatids
gene expression
the number of stages in the cell cycle
Answer:
many things..........
Match each term with its description.
Answer: 1:B 2:A 3:C 4:D
Explanation:
WILL GIVE BRAINLIEST!
what is micro organization?
Answer:
micro organisms are small organisms
Explanation:
Micro-Organisms are those organisms which are so Tiny that they can not be seen with the naked eyes but with the aid of an Electron microscope.
hope it helpful
please make me brainliest
What are the genotypic and phenotypic distributions for the F1 and F2 generations from a cross between a chick with black (BB) feathers and chicken with white (WW) feathers if the color is determined by alleles that show codominance. The heterozygote is an erminette chicken, which is black and white speckled.
Answer:
Please find the punnet square to this question as an attachment
F1 generation:
genotype = BW
Phenotype = Erminette offsprings
F2 generation:
genotype = BB (1): BW(2): WW(1)
Phenotype = 1 Black, 2 Erminette, 1White
Explanation:
This question involves a gene coding for feather color in chickens. The allele for black feathers (B) is codominant with the allele for white feathers (W) to form an erminette chicken (black and white speckles).
According to this question, a cross between a chick with black (BB) feathers and chicken with white (WW) feathers will result in an all erminette chicken (BW) in the F1 generation (see attached image)
Also, in the F2 generation got by self-crossing the Erminette genotype in the F1 generation (BW), the following genotypic and phenotypic ratios are observed:
Genotypic ratio = BB (1): BW(2): WW(1)
Phenotypic ratio = 1 Black, 2 Erminette, 1White
WIll give brainliest 30 points
Food webs show the feeding relationships among different organisms.
According to the food web shown above, what is the relationship between the wheat, the grasshopper, the frog, and the snake?
A.
The snake directly consumes the frog, the grasshopper, and the wheat.
B.
The grasshopper consumes the wheat, and the snake consumes the frog, but there is no connection between the other organisms.
C.
The wheat is directly consumed by both the grasshopper and the frog, and the frog and the grasshopper are directly consumed by the snake.
D.
The wheat is consumed by the grasshopper, the grasshopper is consumed by the frog, and the frog is consumed by the snake.
Answer:
d
Explanation:
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
What caused the chromosomal alteration in the number 21 chromosomes? (LS3.2) A. Part of one chromosome attached to another chromosome B. Some of the genes on a chromosome were reversed C. A duplicated chromosome failed to separate during meiosis D. A part of a chromosome was lost
Answer:
The correct answr is - A. Part of one chromosome attached to another chromosome.
Explanation:
Translocation is one of the chromosome abnormality that cause change in the number of the chromosome. In the translocation a part of the chromosome breaks off and bind or attached to the another chromosome.
The translocation cause various disorderes in individual one of them is Down syndrome which is the result of the alteration of chromosome number 21. In this translocation or specicifically the chromosome portion of chroromosme 14 breaks off and reattaches to the chromosome 21 result in one normal 14 and two normal 21 chromosme so there is trisomy occurs.
Answer:
A duplicated chromosome failed to separate (nondisjunction)
Explanation:
If nondisjunction occurs during meiosis I, homologous chromosomes fail to separate. This produces abnormal gametes that contain two members of the affected chromosome or none. This is why there is an extra chromosome in the 21 chromosomes.
If a plant cell needs energy for endocytosis, what does it use and where does the energy come from?
Explanation:
Active transport uses energy stored in ATP to fuel the transport. ... Endocytosis methods require the direct use of ATP to fuel the transport of large particles such as macromolecules.
Hope this helps!
If a plant cell needs energy for endocytosis, its use and energy come from- Active transport from ATP.
Endocytosis is an energy-using process by which cells internalize molecules by engulfing them.
Endocytosis needs to use directly ATP to fuel the transport of large particles such as macromolecules, parts of cells that can be engulfed by other cells in a process called phagocytosis.Active transport is the movement of molecules across a cell membrane in the direction against their concentration gradient, i.e., moving from a low concentration to a high concentration and this uses cellular energy.Thus, If a plant cell needs energy for endocytosis, its use and energy come from- Active transport from ATP.
Learn more:
https://brainly.com/question/11877274
What are the basic name of the elements that make-up a Macromolecule?
Answer:
Carbon, hydrogen, nitrogen, oxygen, phosphorus and sulfur.
Explanation:
There are around 25 different elements that make up a Macromolecule bit the six most common are carbon, hydrogen, nitrogen, oxygen, and sulfur.
Which details could be included in a biography of Frida Kahlo? Check all that apply.
a description of the first self-portrait Kahlo painted
a story about Kahlo’s childhood pet
an account of the accident in which Kahlo was seriously injured
Kahlo’s impressions of other artists of the time period
a description of a cousin Kahlo never met
an example of how Kahlo influenced artists who came after her
Answer:
The details that could be included in a biography of Frida Kahlo are:
1. a description of the first self-portrait Kahlo painted
3. an account of the accident in which Kahlo was seriously injured
6. an example of how Kahlo influenced artists who came after her
Explanation:
Frida Kahlo was a Mexican painter. She was born in Coyoacan, which at that time was a small bus stop on the outskirts of Mexico City. Her father was a painter and photographer of German-Jewish origin.
Kahlo began painting after a serious traffic accident in 1925. Her lifelong pain after the accident was the subject of many of her images. In addition to personal experiences, she also describes how hard life women lived. She was also influenced by the culture of the Mexican indigenous people, and portrayed them in bright colors, with a mixture of realism and symbolism.
Answer:
1 3 4 6
Explanation:
Explain how specific proteins are formed from a strand of mRNA.
Answer:
During translation, ribosomes move along an mRNA strand, and with the help of proteins called initiation factors, elongation factors, and release factors, they assemble the sequence of amino acids indicated by the mRNA, thereby forming a protein.
Explanation:
Answer:
Explanation:
Los ARN mensajeros, también conocidos como ARNm, son uno de los tipos de ARN que se encuentran en la célula. Éste en particular, como la mayoría de los ARN, se sintetiza en el núcleo y luego se exporta al citoplasma, donde la maquinaria de traducción, la maquinaria que realmente fabrica las proteínas, se une a las moléculas de ARNm y lee en ellas el código para producir una proteína específica. Así que en general, un gen, el ADN de un gen, puede ser transcrito en una molécula de ARNm que puede acabar dando lugar a una proteína específica.
Plants can provide the materials that animals use in
cellular respiration, and animals can provide some
materials needed by plants for photosynthesis. This
image shows the relationship.
According to the diagram, which of these materials
does cellular respiration provide that plants can use in
photosynthesis?
A.) Chemical energy
B.) carbon dioxide
C.) chloroplasts
D.) mitochondria
Answer:
I think B.) carbon dioxide:)
Which product of respiration is considered waste material and leaves the alveoli?
O oxygen
O water
O carbon dioxide
O carbon monoxide
Answer:
In our respiratory system, carbon dioxide is the waste material that we expel when we breathe out. The answer is C, Carbon Dioxide
I hope you have a great day!
The waste product of respiration is
C. Carbon dioxide
The oxygen consumed via stomata is used up by cells.
Respiration in leaves:Oxygen from the air enters a leaf through stomata and reaches all the cells by the process of diffusion. This oxygen is used in respiration in cells of the leaf. The carbon dioxide produced during diffuses out from the leaf into the air through same stomata. The oxygen used by cells in the leaves to disintegrate glucose into water and carbon dioxide.
Thus, option C is correct.
Find more information about Respiration here:
brainly.com/question/18169685
Someone smart PLS HELP!!!!!!!!!!!!! Uranium-235 is a popular choice of fuel for nuclear reactors. But U-235 doesn't always fission the same way. Below are three ways it can split. Complete the nuclear equations so they balance.
fill in the blank line(s) pls pls pls pls pls pls help!!!!!!!
I’m 90% this is right
Sorry if I’m wrong
25. Which of these does natural selection work on?
a. Only animals
b. All populations
c. Only microscopic organism
d. Individuals
e. Only small
Patients wear protective gear when being X-rayed. What substance is being protected directly from mutation?
Answer:
Radiation has a potential of causing germ cell mutations that may be passed on to future generations.
Explanation:
i think so, hopefully this helps;(
Ionizing radiation damage cells and cause double-strand breaks that let more DNA in. These additional fragments of DNA find their way to the nucleus and cause cellular mutations. Protective gears are worn to prevent this.
What are X-rays ?X-rays are a form of electromagnetic wave radiation. Using X-ray imaging, your body's interior can be visualized. The photos depict the various bodily parts in various shades of black and white. This is due to the fact that various tissues absorb radiation in different ways.
Ionizing radiation, a type of radiation that x-rays create, has the ability to destroy living tissue. This is a risk that gets worse the more exposures someone has over the course of their lifetime. However, exposure to radiation normally carries a low risk of acquiring cancer.
Therefore, protective gears are worn during x-rays to avoid mutations.
Learn more about X-rays, here:
https://brainly.com/question/2833441
#SPJ2
What factors can affect how enzymes work?
Explanation:
Enzyme activity can be affected by a variety of factors, such as temperature, pH, and concentration. Enzymes work best within specific temperature and pH ranges, and sub-optimal conditions can cause an enzyme to lose its ability to bind to a substrate.
PLS HELP ASAP
Section 4: Answer the following analysis questions about your proposed solutions. 1. Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. 2 Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. 3. Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. 4. How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs?
Answer:
Section 4: Answer the following analysis questions about your proposed solutions.
Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. The Koalas won’t be extinct.
Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. They will impact because they will be helping.
Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. I would pick the food because they need to have protein to live longer.
How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs? If people want to see them at the zoo, then they should take care of them.
There u go!!!! Hope this helps.
And if someone else answers, can I have the brainliest?
Have an amazing day :D
Protein is found throughout the body—in muscle, bone, skin, hair, and virtually every other body part or tissue.
What is protein?It makes up the enzymes that power many chemical reactions and the hemoglobin that carries oxygen in your blood. At least 10,000 different proteins make you what you are and keep you that way.
Protein is made from twenty-plus basic building blocks called amino acids.
Because we don’t store amino acids, our bodies make them in two different ways: either from scratch, or by modifying others. Nine amino acids—histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine—known as the essential amino acids, must come from food.
Therefore, Protein is found throughout the body—in muscle, bone, skin, hair, and virtually every other body part or tissue.
To learn more about protein, refer to the link:
https://brainly.com/question/17095120
#SPJ5
what is an example of primary ecological succession?
a. plants and animals invading an abandoned crop field
b. lichen growth on rocks
c. minerals spurring rapid plant growth
d. mangroves stabilizing the soils on tropical coasts
Answer:
mangroves stabilizing the soils on tropical coasts.
Some problems with the digestive system make it very difficult for the body to digest enough food. Why would it be harder to exercise when you have a digestion problem like this?
Your cells would not work as well because they would not have energy to break down oxygen from the air.
Your cells would not work as well because they would not have energy to break down oxygen from the air.
You would not get any of the molecules your cells need to exercise.
You would not get any of the molecules your cells need to exercise.
You would need to breathe in a lot more air because your body would have fewer molecules from food.
You would need to breathe in a lot more air because your body would have fewer molecules from food.
Your cells would not work as well because even though they would have enough oxygen molecules from the air, they would not have enough glucose molecules from food.
Answer:
last one
Explanation:
because you having digestive have nothing to do with your oxygen and breathing
Problems with the digestive system make it very difficult for the body to digest enough food, and it is harder to exercise with digestion problems like this because cells would not work as well because they would not have enough glucose molecules, which is the last option.
What is the function of the digestive system during exercise?
Exercise is important for the body, and the digestive system plays an important role in it because the digestive system breaks down the food, and then the simplified food enters the blood and is then taken up by the cells for the different activities. If there are any issues with the digestive system, the food will not be well absorbed into the cells, and no energy will be produced for the exercise.
Hence, the answer is that cells would not work as well because, even though they would have enough oxygen molecules from the air, they would not have enough glucose molecules from food. The last one is the true fact.
Learn more about the digestive system here.
https://brainly.com/question/32531
#SPJ6
The music and pictures connected with a story can also show blas.
A
True
B.
False
Answer:
A
Explanation:
I took the question in a online quiz