Answer:
The correct answer is a. can be activated by the release of epinephrine.
Explanation:
Epinephrine is a hormone and neurotransmitter naturally secreted by the body through the adrenal glands, synthesized and stored in the adrenal medulla and released into the systemic circulation. Epinephrine is a non-selective adrenergic agonist, stimulating alpha1-, alpha2, beta1, and beta2-adrenergic receptors. The systemic actions of catecholamines are mediated by the binding of these compounds to plasma membrane receptors, of the GPCR type widely distributed throughout the body and known as adrenergic receptors, which are activated by the catecholamines adrenaline (epinephrine) and noradrenaline . These receptors cause different effects depending on the G protein subtypes to which they are associated and the signal transduction mechanism linked to the specific G protein.
natural selection selects ___________ less fit individuals .
natural selection selects ____________ viable individuals .
Answer:
viable
Explanation:
Only the animals who are able to survive will live long enough to reproduce
Please help me with please
Which of the substances below are PRODUCTS of the overall chemical reaction of
photosynthesis?
A. ammonia
B. Unitrogen
C. carbon dioxide
D. water
oxygen
sugars
Answer:
essentially glucose and oxygen are the products of photosynthesis
Explanation:
What molecule forms a double helix structure composed of two complimentary strands of nucleotides?
What is the source of the carbon dioxide that is used in photosynthesis?
Answer:
Photosynthetic cells
Explanation:
photosynthetic cells are diverse and are found in green plants during the process of photosynthesis cells use carbon dioxide and energy from the sun to make sugar molecules and make oxygen
two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad
Answer:
A. wheter the producers are located on land or in the water.
Because conservation means using fewer natural resources and reducing wastes, it helps
a.
slow overpopulation and grow food.
b.
prevent habitat destruction and reduce pollution.
c.
prevent biodiversity and destroy species.
d.
stop exotic species and create habitats.
Please select the best answer from the choices provided
A
B
C
D
Answer:
a
Explanation:
just did it
Answer:
the answer should be "B"
We don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
A. True
B. False
Answer:
A. True
Explanation:
Yeah, we don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
Starch is a polysaccharide used as a component of cell walls in plants.
True
False
Answer:
false
Explanation:
is type of carbohydrates
False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.
What are structural component of cell wall?Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.
Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.
Learn more about cell wall, here:
https://brainly.com/question/965751
#SPJ2
Describe the processes involved in photosynthesis
Explanation:
During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. ... Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.
Answer:
During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.
What two taxon make up the scientific name? Pick all that apply.
Kingdom
Phylum
Class
Order
Genus
Family
Species
Answer:
genus and species are combined to form a scientific nameAnswer:
GenusSpeciesExplanation:
The word is genus and species. These two taxon make up the scientific name.
Which best describes why gel electrophoresis works
Answer:
Scientists can determine the size of DNA fragments through a process known as gel electrophoresis. ... Large DNA molecules move slower and can be observed at the top of the gel, whereas smaller DNA fragments move faster and are seen at the bottom of the gel.
mango tree and Vanda ecological interaction
Answer:
The relation between a mango tree and an orchid is commensalism. An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are plants growing on other plants which, however, do not derive nutrition from them.
hope it helps
The growth of two plant saplings A and B, were observed for a period of 6 months. The graph shows the linear growth of the saplings, in centimeters.
After how many months will the heights of the two samplings be the same?
Wich behavior is a response to an external stimulus
Answer:
An external stimulus is a stimulus that comes from outside an organism and causes a reaction. ... Learned behavior is a response to a stimulus that an animal was taught. Being able to read and write are examples of learned behavior, because it is not something you are born able to do.
Explanation:
species I
species II
species III
species IV
Question # 1: Which shape is CLOSEST to the truth for the shape of planet 1 point
Earth?
1. Which object best represents a true scale model
of the shape of Earth? (1) a table tennis ball
(2) a football (3) an egg (4) a pear
Option 1
Option 2
Option 3
Option 4
Answer:
(1) a table tennis ball
Explanation:
The earth will most closely resemble any type of sphere or circular ball.
Macroscopic urinalysis collects data on all EXCEPT which of the following?
A. turbidity
B. color
C. pH
D. odor
Answer:
The correct answer is - pH.
Explanation:
Macroscopic urinalysis is the evaluation of the physical appearance of the urine. It evaluates the amount, color, odor and clarity, and other physical appearances or characteristics.
It also checks if there are any clotting, or sediments are found in the sample. It does not include the pH of the urine in the microscopic urinalysis. It is recommended to check underlying medical conditions.
Why do potato plants no longer need to use glucose from starch in respiration once they have grown above ground?
Which correctly describes the projected growth of the world's population in
the future?
A. The rate of growth will remain the same.
B. It will not grow much higher than it is now.
C. The population will eventually begin declining.
D. The rate of growth will slow down by 2100.
Answer:
D the rate of growth will slow down by 2100
Explanation:
Sorry if it’s wrong
World's population growth rate will slow down by 2100 in future.
What is world's population growth ?The rise in the number of people in a population or dispersed group is known as population growth. Global population growth is roughly 83 million people per year, or 1.1 percent per year. From 1 billion in 1800 to 7.9 billion in 2020, the world's population has increased dramatically. What will be the world's population growth rate in future?The world's population is expected to reach 10.9 billion by 2100 in future, with yearly growth of less than 0.1 percent – a significant decrease from present rates. Between 1950 and today, the world's population increased by 1% to 2% per year, going from 2.5 billion to more than 7.7 billion people.Hence, the correct option is D.
To know more about population growth here,
https://brainly.com/question/17487289
#SPJ2
Choose the combination of factors that creates snow.
Answer:
Relative Humidity- Low
Air tempurature-cold
Air Pressure-low
Explanation:
High pressure, warm temperatures, and high humidity are factors that creates snow.
What are the factors that create snow?Snow and/or ice formation requires temperatures below freezing, both in the atmosphere and close to the ground.
Something that will induce the moist air to rise, forming clouds and precipitation, moisture, produces precipitation and clouds.
Water that has frozen solidly is snow, and the atmosphere (layer of gases around Earth) contains water in the form of vapor (gas). When there is a lot of vapor present, clouds develop, fill up with water droplets, and eventually begin to rain.
Therefore, when a very cold water droplet freezes onto a pollen or dust particle in the atmosphere, a snowflake starts to form.
Learn more about snow, here:
https://brainly.com/question/29372094
#SPJ2
Many functions in the body are controlled by
special compounds. Which statements about
these compounds do you think are true? Check
all that apply.
The body can make all of the compounds it
needs.
.
The body gets energy from some
compounds.
um
Some compounds determine physical
characteristics.
Answer:
Its either a or b
Explanation:
A say the body can make all of the compound its need
my suggestion compound are made up of water ,mineral protein carbs and fat
our body produce little nutrients so we need to eat to get the nutrients we need
im am going with b
B is the answer
I’m 98% sure it’s c but it might be B could someone check pls
Answer:
I think C
Have a great day
[tex]#Liliflim✌[/tex]
Answer:
Explanation:
A
What is the
Magnification
of a plant cell?
Answer:
400x
Explanation:
hiii! ill give brainliest if u answer this :))
Why are enzymes important?
1. They contain the genetic material.
2. They speed up chemical reactions.
3. They bring water into the cell.
4. They help the cell maintain its shape.
What could be inferred from suntans?
Group of answer choices
A tan might indicate sun damage to the skin.
Tanning produces healthier skin.
A tan strengthens the elastic in the skin.
Tanning makes skin look younger.
Answer:
A tan might indicate sun damage to the skin.
Explanation:
Tanning is the process by which the skin is exposed to the ultraviolet rays that comes from the sun with the purpose of producing a dark-brown coloration called a TAN.
A tan achieved by exposure to the sun can actually indicate that a person's skin is undergoing damage from the UV rays of the sun, hence, the skin responds by producing a protein called melanin, which protects the skin and later forms the dark coloration- tan. From this explanation, tan is got in response to a damaging signal received by the cell, hence, a tan might indicate sun damage to the skin.
the tRNA for GUCAUCGAUCGAUCGGAUGCC
Answer:
CAGUAGCUGCUAGCCUACGG
Explanation:
A and U are opposites
C and G are opposites
so you would do the opposite that would correspond.
PLEASE HELP WILL MARK BRANLIEST!
Fungi and bacteria are examples of _____:
A. decomposers, B. producers, C. consumers, D. demagorgans
Answer:
a. decomposers
Explanation:
Bacteria and fungi are best classified as decomposers. They decompose the bodies of dead plants and animals.
which two molecule do green plants use to make glucose
Answer:
Carbon Dioxide and Water
SCIENCE
Which of the following is an example of a glacial formation?
(Don’t put a random answer or spam things or I will report you and you will lose the points)
A. Photosynthesis
B. Methane degradation
C. Photolysis
D. Weathering of rocks
Answer:
The correct answers is letter D.
Explanation:
Base on my research Weathering of rocks or Weathering loosen of rocks are examples of a glacial formation