According to Philip Tetlock, there are two fundamental ways to assess the accuracy of subjective probabilities. One is measured as the ability to assign subjective probabilities to outcomes that correspond to their objective probabilities. For example, when you say there is a 70% chance of something happening, the things that you are saying that 70% likelihood to occur about 70% of the time. This is an example of

Answers

Answer 1

According to Philip Tetlock, one fundamental way to assess the accuracy of subjective probabilities is by measuring the ability to assign them to outcomes that correspond to their objective probabilities.

This means that if someone says there is a 70% chance of something happening, they are saying that it will occur about 70% of the time. This is an example of how subjective probabilities can be evaluated for accuracy. This is an example of Calibration.

Any individual's assessment of an event's probability is known as a subjective probability. Although it may not appear very scientific, this is frequently the best you can do when you lack both theory and experience, making it impossible to employ relative frequency or theoretical probability.

Calibration is a method for evaluating the accuracy of subjective probabilities concerning their objective probabilities.

Learn more about Probabilities :- https://brainly.com/question/13604758

#SPJ11


Related Questions

Help :(

What are
Results/achievements/data from mission Apollo 15.

-describe some of the data returned) what successes are described related to the goal of the mission?

Answers

Answer:completed the fourth human landing

Explanation:

in a study of color perception, 340 men are tested, and 102 are found to have red/green color blindness.. 1. Þ= 2. npr 3. n(1 – P)= 4. Is np > 5? (yes or no) 5. Is n(1 – Ô) > 5? (yes or no) 6. The margin of error is use the 97 % confidence level Round z-values to 2 decimals. Round your margin of error to 3 decimals. 7. Construct a 97 % confidence interval for the percent of men in general population who are color blind. Lower Bound Upper Bou

Answers

The key number for 94% confidence is z0.03=2.75z0.03=2.75.  We're looking for our sample, therefore I'm going to assume that. Visual Impairment In a study of perception, 7 out of 80 men who were evaluated had red > green colour blindness.

Std error = (p(1-p)/n)0.5 since the mean percentage is p = 7/00 = 0.0875. A booklet with images of bubbles and designs is turned in front of the audience. Human vision uses three colour axes (red-green, blue-yellow, and black-white), according to a study that has since been repudiated by its authors. Visual Impairment In a study of perception, 7 out of 80 men who were evaluated had red > green colour blindness. Std error = (p(1-p)/n)0.5 since the mean percentage is p = 7/00 = 0.0875.

To know more about Visual Impairment, click here:

https://brainly.com/question/30324647

#SPJ4

In a study of color perception, 340 men are tested, and 85 are found to have red/green color blindness. 1. Þ= 2. npr 3. n(1 – P)= 4. Is np > 5?

Which explanation best explains why we have trouble perceiving certain memories?
Group of answer choices
A) The connections and associations of our memories begin to weaken as the myelination of neurons diminishes over time.
B) New experiences and memories interfere with our older memories by rewiring and co-opting older memory neurons and associating them with more recent experiences.
C) As time passes by our neural connections weaken and we are less and less likely to be able to access our memories.
D) Since our brain has limited ability to store memories, as we experience more in life, newer memories replace older ones much like a computer rewriting data over older data.

Answers

We have trouble perceiving certain memories because New experiences and memories interfere with our older memories by rewiring and co-opting older memory neurons and associating them with more recent experiences. The correct answer is option b.

This phenomenon is called interference and occurs when new information disrupts the recall of older information, leading to forgetting or difficulty in retrieving certain memories.

The brain rewires and co-opts older memory neurons with more recent experiences, leading to changes in the original memory's associations and connections, which can make it harder to retrieve or perceive the original memory accurately.

This interference is a natural and necessary part of memory formation and retention, but it can sometimes lead to difficulty in recalling certain memories.

The correct answer is option b.

To know more about interference refer to-

brainly.com/question/16098226#

#SPJ11

What is the correct definition of physical activity according to the Surgeon General's Report?
A) voluntary movement intentionally performed for specific purposes and that requires a substantial amount of energy
B) all movements, voluntary and involuntary, performed by humans
C) voluntary movement intentionally performed in order to achieve a goal in sport, exercise, or any other sphere of life experience
D) bodily movement that is produced by the contraction of skeletal muscle and that substantially increases energy expenditure

Answers

The correct definition for physical activity according to the Surgeon General's Report is bodily movement that is produced by the contraction of skeletal muscle and that substantially increases energy expenditure.

This category includes activities including walking, running, swimming, cycling, and strength training. The study underlines that even little quantities of physical activity can have significant health benefits and that physical activity doesn't have to be challenging or time-consuming to be beneficial. According to the study, adults should engage in at least 150 minutes of moderate to vigorous activity each week, and they should perform muscle-strengthening activities on at least two days per week. The correct definition of physical activity according to the Surgeon General's Report is:
D) bodily movement that is produced by the contraction of skeletal muscle and that substantially increases energy expenditure.

Learn more about Surgeon General:

https://brainly.com/question/15826322

#SPJ11

list the archeon provinces and cratons of north america

Answers

The North American continent is made up of several Archeon provinces and Cratons where Archeon provinces have the Superior Province, the Slave Province, the Wyoming Province, and Cratons has the Canadian Shield, the Greenland Shield, and the North American Craton.

These Archeon provinces and cratons are ancient geological formations that played a significant role in the formation and development of the North American continent. Archeon provinces are ancient regions of the Earth's crust that date back to the Precambrian era, and Cratons are stable regions of the Earth's crust that are typically found in the interior of continents.  

The Archean provinces and Cratons of North America are:

1. Superior Province: The largest Archean province in North America, located in the Canadian Shield, and includes parts of Quebec, Ontario, Manitoba, and Nunavut.
2. Slave Province: Located in the Northwest Territories and Nunavut, Canada, it contains the Acasta Gneiss, which is one of the oldest known rocks on Earth.
3. Wyoming Province: Found in the western United States, it covers parts of Montana, Wyoming, Idaho, and South Dakota.
4. Hearne Province: Located in northern Canada, it stretches across parts of Nunavut, Saskatchewan, and Manitoba.
5. Rae Province: Situated in the central Canadian Shield, it spans parts of Nunavut, Saskatchewan, and the Northwest Territories.
6. Nain Province: Located in Labrador, Canada, it is an Archean craton in the northeastern part of the Canadian Shield.

So, to summarize, some of the Archeon provinces of North America include the Superior Province, the Slave Province, and the Wyoming Province. And some of the cratons of North America include the Canadian Shield, the Greenland Shield, and the North American Craton.

To learn more about Cratons visit:

https://brainly.com/question/14969766

#SPJ11

one of the controversies that surrounds gardner's theory of multiple intelligences is whether

Answers

One of the controversies that surrounds Gardner's theory of multiple intelligences is whether: the different types of intelligence are truly independent from one another

The various types of intelligences he proposes can be considered as distinct and independent forms of intelligence, or if they are simply interconnected aspects of a more generalized intelligence.

Gardner's theory identifies eight different types of intelligences, including linguistic, logical-mathematical, spatial, bodily-kinesthetic, musical, interpersonal, intrapersonal, and naturalistic.

Critics argue that there is not enough empirical evidence to support the idea that these intelligences operate independently of one another, and that they may instead represent different facets of a single, unified intelligence.

Additionally, some researchers question the validity of the assessment methods used to measure these individual intelligences, as they may not accurately capture the full range of human cognitive abilities.

Critics also argue that the theory of multiple intelligences may have educational implications that are not well-supported by research, such as the idea of tailoring instruction to individual students' specific intelligence profiles.

In summary, the main controversy surrounding Gardner's theory of multiple intelligences centers around the question of whether the proposed intelligences are distinct and independent, or if they are simply different aspects of a single, generalized intelligence.

This debate is fueled by concerns about the validity of assessment methods and the potential educational implications of the theory.

To know more about Gardner's theory, refer here:

https://brainly.com/question/30337559#

#SPJ11

Complete question:

one of the controversies that surrounds Gardner's theory of multiple intelligence is whether:

QUESTION 6 Research by UCR's Dr. Reynolds demonstrates that cognitive development is affected by (select all that apply): a early life experiences b.sociocultural context c. historical context d. individual behaviors

Answers

According to Dr. Reynolds' research at UCR, cognitive development is affected by multiple factors. These include:

a) Early life experiences: Events and interactions in the early stages of life play a crucial role in shaping cognitive abilities.

b) Sociocultural context: The social and cultural environment in which an individual is raised can significantly impact cognitive development.

c) Historical context: The era and societal conditions during an individual's upbringing can influence cognitive growth.

d) Individual behaviors: Personal choices and behaviors can also contribute to one's cognitive development.

So, based on Dr. Reynolds' research, all four options (a, b, c, and d) apply.

To know more about cognitive development click on below link :

https://brainly.com/question/28011228

#SPJ11

identify the human resource activities that could involve risks at castro benende corporation.

Answers

There are several human resource activities that could involve risks at Castro Benende Corporation. These include Recruitment and Selection, Employee Relations, Training and Development, Performance Management, and Health and Safety.

1. Recruitment and Selection: The process of hiring new employees can be risky if not done carefully. Castro Benende Corporation should ensure that they have a fair and objective selection process to avoid any legal issues related to discrimination or bias.

2. Employee Relations: Employee relations is another area where risks can arise. For example, if the company does not have clear policies and procedures for dealing with employee complaints or grievances, it could result in legal action or damage to the company's reputation.

3. Training and Development: The company must ensure that its employees are adequately trained to perform their job duties. If employees are not properly trained, it could result in poor job performance, accidents, or legal issues.

4. Performance Management: The performance management process can be risky if not handled correctly. Employees should be evaluated based on objective criteria to avoid any legal issues related to discrimination or bias.

5. Health and Safety: Ensuring the health and safety of employees is essential. Castro Benende Corporation should have a comprehensive health and safety program to prevent accidents or injuries in the workplace. Failure to do so could result in legal action or damage to the company's reputation.

Overall, it is essential for Castro Benende Corporation to implement proper policies and procedures in these areas to minimize risks and ensure the smooth functioning of the human resource department.

Learn more about Human resources at https://brainly.com/question/20749711

#SPJ11

Chicago School sociologist ____ is credited with the founding of Hull House, one of the most famous settlement houses in an impoverished area of Chicago.
Harriet Martineau
Karl Marx
Jane Addams

Answers

Jane Addams is the Chicago School sociologist who is credited with the founding of Hull House. Hull House was one of the most famous settlement houses in an impoverished area of Chicago. It was established in 1889 and provided a range of social services to immigrants and the poor, including education, childcare, and healthcare.

Addams was a pioneer in the settlement house movement, which sought to address the social problems created by industrialization and urbanization. She believed that social reform could be achieved through education, and her work at Hull House helped to shape the field of social work. Addams was also a prolific writer and speaker, and she used her platform to advocate for women's rights, peace, and social justice. Her legacy continues to influence the field of social work today, and her approach to addressing social problems through community-based solutions and education remains relevant. The content-loaded Chicago School sociologist, Jane Addams, was a trailblazer in the field of social work and her work at Hull House is an enduring testament to her dedication to improving the lives of those in need.

To know more about sociologists

https://brainly.com/question/14363783

#SPJ11

the fuzziness in our diagnostic systems is inherent in the fact that psychological problems fall along a

Answers

The fuzziness in our diagnostic systems is inherent in the fact that psychological problems/issues fall along a Continuum.

Mental health and mental illness are polar opposites, and the mental health spectrum represents a range of conditions. A person can be at any point along the continuum, depending on their internal and external capabilities at a point in time, changing positions as circumstances get better or worse.

The continuum model of mental health has a linear view of the human mind. It offers suggestions for overcoming difficulties and helps practitioners identify specific behavioral patterns that require attention. Today's top he leaders and managers often use the mental health continuum model as a trusted self-help tool for workplace professionals.

To learn more about continuum, here:

https://brainly.com/question/28192042

#SPJ4

Complete question:

The fuzziness in our diagnostic systems is inherent in the fact that psychological problems fall along a _______

The struggle to define and integrate a sense of who one is, what one is to do in life, and what one’s values should be is referred to by Erikson as
Question 4 options:
a. a season of life
b. an identity crisis
c. a moral dilemma
d. a psychosexual stage of adolescence

Answers

The correct answer is b. an identity crisis.

According to Erik Erikson's theory of psychosocial development, the struggle to define and integrate a sense of self, purpose, and values during adolescence is referred to as an identity crisis. Erikson proposed that during adolescence, individuals go through a stage called "Identity vs. Role Confusion," where they grapple with questions of who they are, what they want to do in life, and what values they hold. This process involves exploring various roles, beliefs, and values, and ultimately developing a sense of identity. It is a critical period of self-discovery and self-definition that lays the foundation for adulthood.

To know more about crisis click here:

brainly.com/question/9193418

#SPJ11

The individual needs met by participating in the social institution of work include ____.
providing for the economic system functioning
shaping, in part, the roles of other social institutions as they support the effective functioning of the economic system
providing a sense of purpose in life
none of the above

Answers

The individual needs met by participating in the social institution of work include a) "providing for the economic system functioning, b) shaping, in part, the roles of other social institutions as they support the effective functioning of the economic system, and c) providing a sense of purpose in life.

The individual needs met by participating in the social institution of work include all of the options listed. Work provides individuals with the means to provide for their economic needs, which is a crucial function of any society's economic system. Additionally, work shapes other social institutions to support the economic system, such as education and government policies. Work can also provide individuals with a sense of purpose in life, as it allows them to contribute to society and feel a sense of accomplishment.

Thus, options a , b and c are answers.

You can learn more about  social institution at

https://brainly.com/question/29788770

#SPJ11

Contemporary Gestalt therapists view client resistance as a: a. ​ way that clients avoid confrontation.
b. ​ sign of poor motivation for therapeutic work.
c. ​ therapy interfering force that needs to be overcome.
d. ​ creative adjustment to a situation and something to be respected

Answers

Contemporary Gestalt therapists view client resistance as a creative adjustment to a situation and something to be respected.  The answer is d.

Resistance is seen as a necessary aspect of the therapeutic process, indicating that the client is actively engaged in the therapy and attempting to find their own solutions to their problems.

Rather than viewing resistance as a negative force to be overcome, Gestalt therapists aim to work with the client's resistance, exploring its meaning and function, and helping the client to become more aware of their patterns of behavior.

The therapist will encourage the client to become more fully present in the therapeutic moment, exploring their resistance through experimentation and dialogue. By doing so, the therapist can help the client to achieve greater self-awareness and develop new ways of coping with their problems. Thus, d. is the correct answer.

To know more about creative adjustment, refer here:
https://brainly.com/question/4121462#
#SPJ11

what are the key issues that contribute to intergenerational conflict in social welfare policies and programs? what would you recommend as a social welfare policy or program response to these issues?

Answers

Intergenerational conflict also refers to differences in culture, society, or the economy that may result from conflicts between younger and older generations over changing ideals.

What is Intergenerational conflict?

Intergenerational conflict also refers to differences in culture, society, or the economy between generations that may result from a generational value shift or conflict between younger and older generations. A different set of values is being guarded by each generation, and these values may be at danger if there is disagreement. For instance, while Gen Xers want to make a unilateral decision and move on, ideally alone, baby boomers value teamwork, cooperation, and buy-in. Intergenerational conflict can refers to generational differences in culture, society, or economy. Value shifts or conflicts of interest between younger and older generations may be the source of these.

To learn more about Intergenerational conflict click,

https://brainly.com/question/3477216

#SPJ1


Psychological Intimacy:
is emotional and psychological closeness to other team or group members. It results of affection and warmth, unconditional positive regard, oppurtunity for expression, security, and emotional support, and nuturing.

Answers

Psychological intimacy refers to the emotional and psychological closeness that is developed among team or group members.

It goes beyond surface-level interactions and involves a deeper level of connection and understanding. Psychological intimacy is fostered through affection, warmth, and unconditional positive regard, where team members feel accepted and valued for who they are. It also involves creating an environment where team members feel safe and supported in expressing themselves, sharing their thoughts and feelings, and receiving emotional support. Nurturing relationships, providing opportunities for open communication, and creating a sense of security within the team or group can contribute to the development of psychological intimacy, which in turn can strengthen team cohesion, collaboration, and overall team performance.

To know more about intimacy click here:

brainly.com/question/30663793

#SPJ11

The water vapor feedback loop acts as it does because:a. water vapor is a greenhouse gas and an increase in temperature means that the air can hold more water vaporb. an increase in temperature will cause it to rain more, and the atmosphere will lose water vapor.c. water vapor is a greenhouse gas and an increase in temperature means that more clouds will formd. an increase in temperature causes more weathering to occur, removing CO­2 fr

Answers

The water vapor feedback loop acts as it does because water vapor is a greenhouse gas and an increase in temperature means that the air can hold more water vapor. The correct answer is option a.

Water vapor is a potent greenhouse gas, meaning it traps heat in the Earth's atmosphere, contributing to the warming of the planet. When the Earth's temperature rises, the atmosphere can hold more water vapor, which in turn traps more heat, leading to further warming. This positive feedback loop can amplify the initial warming caused by other factors, such as increased levels of carbon dioxide in the atmosphere.

Therefore, the correct option is (a): water vapor is a greenhouse gas and an increase in temperature means that the air can hold more water vapor.

Learn more about greenhouse gas:

https://brainly.com/question/12684997

#SPJ11

The water vapor feedback loop acts as it does because water vapor is a greenhouse gas and an increase in temperature means that the air can hold more water vapor. The correct answer is option a.

Water vapor is a potent greenhouse gas, meaning it traps heat in the Earth's atmosphere, contributing to the warming of the planet. When the Earth's temperature rises, the atmosphere can hold more water vapor, which in turn traps more heat, leading to further warming. This positive feedback loop can amplify the initial warming caused by other factors, such as increased levels of carbon dioxide in the atmosphere.

Therefore, the correct option is (a): water vapor is a greenhouse gas and an increase in temperature means that the air can hold more water vapor.

Learn more about greenhouse gas:

https://brainly.com/question/12684997

#SPJ11

How can any piece of music having meaning beyond its immediate culture and generation? Are there any specific elements that might destine a particular work for greatness? At least 120 words

Answers

A piece of music is considered great and has lasting meaning beyond its culture and generation depends on the individual listener's interpretation and connection with the music. Great music is not limited by time or place and can continue to inspire and move people for generations to come.

Music, like any form of art, has the power to transcend time and place. A piece of music can have meaning beyond its immediate culture and generation if it is able to evoke emotion and connect with the human experience. Great music has the ability to communicate universal truths and emotions that are relevant to people of all cultures and generations.

Specific elements that might destine a particular work for greatness include the complexity and originality of the composition, the skill and artistry of the performers, and the ability of the music to connect with and influence listeners on a deep level. Additionally, a piece of music that reflects the cultural values and traditions of its time and place can also have lasting significance and meaning beyond its original context.

Ultimately, whether a piece of music is considered great and has lasting meaning beyond its culture and generation depends on the individual listener's interpretation and connection with the music. Great music is not limited by time or place and can continue to inspire and move people for generations to come.

Learn more about listener's interpretation  here

https://brainly.com/question/13446914

#SPJ11

Question 7 of 20
What is one way political parties shape public policy?
OA. Voting on the issues that are of most concern to party members
B. Working toward dissolving the two-party system
C. Creating and passing legislation
O D. Helping elected officials who belong to the party work together
more effectively
SUBMIT

Answers

A way in which political parties shape public policy is by creating and passing legislation. The Option C is correct.

How do political parties influence public policy?

The most significant way is introducing and passing of legislation that aligns with their party's platform and values, so, the parties play a crucial role in shaping policy by advocating for their preferred policies, mobilizing their members to vote and support their candidate  and working with elected officials to advance their agenda.

Through legislative process, the parties can shape public policy by bringing attention to issues that matter most to their members and promoting their policy solutions.

Read more about Public policy

brainly.com/question/1064937

#SPJ1

identify the big five personality factor that describes whether an individual is independent or conforming.

Answers

Openness to new experiences is one of the major five Personality factors that determine whether a person is independent or conformist.

Personality is a structure of interconnected cognitive, behavioral, and emotional patterns that are impacted by biological and environmental influences. These associated patterns are moderately stable over the long term, but they vary over the course of a lifetime.

Moods, attitudes, and opinions are all parts of personality, and interactions with other people are where it shines the brightest. It consists of both innate and taught behavioral characteristics that distinguish one person from another and are demonstrated in how they relate to their environment and social group.

According to a review published in Nature Human Way of Behaving, the normal, saved, good example and narcissistic character kinds may change individuals' opinions on character overall.

To know more about Personality,

brainly.com/question/2249291

#SPJ4

falling trade barriers are facilitated by the wto. group of answer choices true false

Answers

The given statement, " falling trade barriers are facilitated by the WTO" is true because the WTO (World Trade Organization) manages the world trade system and aids poorer nations in increasing their trade capability.

Additionally, it offers a platform for members to bargain commercial deals and settle trade disputes with one another.

The World Trade Organization (WTO) works towards reducing trade barriers and facilitating trade between countries. It achieves this through negotiations, agreements, and dispute settlement mechanisms. As trade barriers are reduced, countries can trade more freely with each other, leading to increased economic growth and development.

The World Trade Organization (WTO) is an international organization that promotes free trade and reduces trade barriers between its member countries. By implementing policies, negotiating trade agreements, and settling disputes, the WTO facilitates the reduction of trade barriers and encourages global trade.

Thus the given statement is True.

Learn more about  Trade :- https://brainly.com/question/17727564

#SPJ11

the width of "grid boxes" for most current global climate models is about _____ km.

Answers

The width of "grid boxes" for most current global climate models is about 100 km. This refers to the size of the cells in the grid system that is used to simulate and model the Earth's climate and its interactions with various factors such as ocean currents and atmospheric conditions.

The grid size can vary depending on the specific model and the area of the world being , but a common standard is a grid box size of around 100 km the width of grid boxes for most current global climate models is about 100 km. In these models, climate variables like temperature, precipitation, and wind are represented on a grid, with each box covering a specific area, and the grid box size impacts the resolution of the model's output the Earth's climate and its interactions with various factors such as ocean currents and atmospheric conditions.

Learn more about grid boxes here:

https://brainly.com/question/15857254

#SPJ11

Ananda is involved in decision making and feels that she is making a significant contribution to the organization.it is called_____

Answers

Ananda participates in decision making and believes she makes a significant contribution to the organisation. It is known as intrinsic reward.

What exactly is intrinsic reward?

An intrinsic reward is an internal reward that workers receive for successfully completing their tasks or projects. These rewards are mostly psychological and are based on a person's effort and abilities. Participating in a sport because it is enjoyable rather than to win an award. Learning a new language because you enjoy new experiences rather than because your job requires it. Intrinsic rewards elicit a positive emotional response and work to motivate employees to keep striving for excellence and make long-term behavioural changes when necessary.

To know about intrinsic value visit:

https://brainly.com/question/30869200

# SPJ1

anne is worried because the only students who are willing to participate in her study are those who consistently make the dean’s list. anne is most likely concerned about the:

Answers

Anne is most likely concerned about the potential lack of diversity or representativeness in her study sample. By only including students who consistently make the dean's list, her findings may not be generalizable to the wider population of students. This could impact the validity and reliability of her study results. She is most likely concerned about the "selection bias" in her study.

This is because the only students willing to participate are those who consistently make the dean's list, which may not represent the entire student population accurately. By having a sample limited to high-achieving students, her results may not be generalizable to the broader population.

Learn more about Anne Frank here: brainly.com/question/18543588

#SPJ11

According to Drugs in American Society, the "doomsayers" who argue that, in all likelihood, the worst case scenario-a huge increase in harmful drug abuse-will come about under drug legalization are wrong (true or false)

Answers

True. According to Drugs in American Society, the "doomsayers" who argue that the worst-case scenario, which is a huge increase in harmful drug abuse, will come about under drug legalization are wrong.

While some concerns regarding drug legalization are valid, it is essential to analyze the potential outcomes and benefits, such as regulation, reduction in drug-related crime, and the ability to focus on education and treatment, rather than assuming the worst-case scenario will occur. The argument that drug legalization would inevitably lead to a huge increase in harmful drug abuse is often made by opponents of drug policy reform. However, this argument is not supported by the available evidence.

Studies have shown that drug legalization, or at least decriminalization, can actually lead to reduced drug use and related harms. For example, Portugal decriminalized the possession of small amounts of drugs in 2001, and since then, drug use and drug-related harms have decreased. This has been attributed to a shift in focus from punishing drug users to treating drug addiction as a public health issue and providing access to treatment and harm reduction services.

Learn more about legalization here:

https://brainly.com/question/14994055

#SPJ11

accepting personal responsibility maximizes the control we have over the outcomes and experiences of our lives. (True or False)

Answers

Answer:

I believe this to be true. If I'm wrong please leave it in the comments!

In his research conducted in the Trobriand Islands, Bronislaw Malinowski employed an early form of what type of anthropological theory?
a.historical particularism
b.epigenetics
c.structural functionalism
d.unilineal cultural evolutionism

Answers

Bronislaw Malinowski employed a type of anthropological theory known as structural functionalism in his research conducted in the Trobriand Islands. This theory was popularized in the mid-20th century by anthropologists such as A.R. Radcliffe-Brown and Talcott Parsons.

Structural functionalism is focused on analyzing the relationships between social institutions and their functions within a society. It emphasizes the interdependence of different social structures and institutions and how they work together to maintain social stability and cohesion.

In Malinowski's research, he applied this theory by examining the social and cultural practices of the Trobriand Islanders and how they functioned to maintain their society. He studied their economic systems, kinship structures, and religious beliefs, and analyzed how they were interconnected and contributed to the overall stability of the Trobriand society.

It is important to note that Malinowski's approach to structural functionalism was an early form of the theory and has since been critiqued and developed by later anthropologists. Nonetheless, his research in the Trobriand Islands remains an important contribution to the field of anthropology and exemplifies the use of structural functionalism in anthropological research.

Know more about Bronislaw Malinowski here:

https://brainly.com/question/29999960

#SPJ11

involvement in multiple communities reinforces an individual’s sense of belonging. true or false?

Answers

The statement "involvement in multiple communities reinforces an individual's sense of belonging" is true because, multiple communities can strengthen an individual's sense of belonging.

When a person is involved in multiple communities, it means that they have a diverse range of interests and are exposed to a variety of people and ideas. This allows them to build connections and relationships with people who share similar interests, values, and beliefs, which can increase their sense of belonging.

Involvement in multiple communities can also provide a sense of purpose and fulfillment, as individuals have the opportunity to contribute to different causes and initiatives. This can lead to a greater sense of identity and a deeper understanding of one's place in the world.

Furthermore, being involved in multiple communities can help individuals develop important skills such as communication, leadership, and collaboration, which can be valuable in both personal and professional contexts.

Overall, involvement in multiple communities can strengthen an individual's sense of belonging, providing them with a network of support, a sense of purpose, and a broader perspective on the world.

To know more about communities, refer here:

https://brainly.com/question/30450248#

#SPJ11

one sample of n = 5 scores has a variance of s2 = 10 and a second sample of n = 10 scores has s2 = 20. what can you conclude about the pooled variance for these two samples?a. closer to 10 than to 20
b. closer to 20 than to 10
c. exactly half way between 10 and 20
d. cannot be determined without more information

Answers

The correct option is D i.e., cannot be determined without more information.


When there is a correlation between pooled data sets or when the average of the data sets is not the same, the pooled variance is an estimate. The greater the non-zero correlation or the more apart the averages between the data sets, the less accurate the pooled variation. By combining the variances from two or more samples, the pooled variance determines the population variance. In statistical techniques where different samples from the same population or samples from separate populations yield estimates of the same variance, the pooled variance is frequently utilized.


To calculate the pooled variance, we need the sum of squared deviations from the mean for each sample, which cannot be determined with just the given variances and sample sizes.

To learn more about Pooled variance, click here:

https://brainly.com/question/30761583

#SPJ11

elizabeth is in the midst of a manic episode. her mind seems to be racing so quickly that she can't even express her thoughts because her mouth cannot keep up. elizabeth is experiencing a symptom of mania known as

Answers

Elizabeth is experiencing a symptom of mania known as "flight of ideas." This occurs when a person's thoughts race so rapidly that they cannot keep up with them, resulting in fragmented and disjointed speech.

The individual may jump from topic to topic, making it difficult for others to follow their train of thought. This symptom is often associated with bipolar disorder, a condition in which individuals experience periods of extreme mood swings that alternate between manic and depressive episodes.

During manic episodes, individuals may also exhibit other symptoms such as elevated mood, decreased need for sleep, increased energy, impulsivity, and grandiosity. It is important for Elizabeth to seek professional help and treatment from a mental health provider to manage her symptoms and prevent further complications.

Treatment options may include medication, therapy, and lifestyle changes to help stabilize her mood and improve her overall well-being.

To know more about flight of ideas visit:

https://brainly.com/question/30397961

#SPJ11

during a waas gps approach, you receive an lnav v annunciation on the gps display. you should

Answers

The pilot should cross-check the GPS information with other navigational aids and follow proper procedures for the approach.

During a WAAS GPS approach, if you receive an LNAV/V annunciation on the GPS display, it means that the aircraft is not properly following the lateral navigation (LNAV) path and is instead deviating from the desired track. To correct this, the pilot should select the VNAV (vertical navigation) mode and ensure that the aircraft is descending on the correct glide slope. It is important to follow the guidance provided by the GPS and adjust the aircraft's heading and altitude as necessary to remain on the correct approach path. Additionally, the pilot should cross-check the GPS information with other navigational aids and follow proper procedures for the approach.

Learn more about navigational aids here

https://brainly.com/question/13869220

#SPJ11

Other Questions
16.5 ft tall giraffe casts a 12-ft. shadow. at the same time a zookeeper casts a 4-ft shadow how tall in feet is the zookeeper how many grams of na2co3 (fm 105.99) should be mixed with 5.00 g of nahco3 (fm 84.01) to produce 100 ml of buffer with ph 10.00? After plotting the voltage waveform, obtain a 0.2-mp expressions and generate plots for (t), p (t), and w (t) for i by capacitor. The voltage waveforms are given:(a) v_1(t) = 5r(t) - 5r(t 2) V (b) v_2(t) = 10u(-t) + 10u(t) - 5r(t-2) + 5r(t-4) V (c) v_3(t) = 15u(-t) + 15e^(-0.5t) u(t) V (d) v_4(t) = 150[1 - e^(-0.5t)] u(t) V angles of a triangle Are dichotomous keys purely a human invention? Explain. in galatians, paul uses ___________ as an example of one justified by faith. It is recommended to interview the HIS users to identify vital information to daily operation in contingency planning True False Which network topology is the most reliable and why?OA. Ring topology, because data flows in one direction from node tonode around the ringB. Star topology, because the server manages all network traffic inone location, making it convenientC. Bus topology, because on large networks it is easy to fix if a cablefails and all nodes lose connectionD. Fully connected mesh topology, because it provides a connectionfrom each node to every other node in the network A rule that CANNOT be violated by database users is called a:(A) password.(B) program.(C) constraint.(D) view. Which of the following variables of an asteroid collision affects the impact crater they leave behind?O SizeO SpeedO MassO All of the above 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? You are spinning two identical balls attached to strings in uniform circular motion, Ball 2 has a string that is twice as long as the string with ball 1, and the rotational speed (v) of ball 2 is three times the rotational speed of ball 1. What is the ratio of the centripetal force of ball 2 to that of ball 1? Select all of the ratios that are equivalent to 1:5. What starting alkyl halide and ketone would give 2-methyl-2-pentanol? Write a grignard synthesis for this reaction. Please help!!!There is a photo! Pleasee help!! to the principal for remission of fine What are the bond angles? You want to buy a house within 3 years, and you are currently saving for the down payment.You plan to save $5000 at the end of the first year, and you anticipate that your annual savingswill increase by 10 % annually thereafter. Your expected annual return is 7%. How much wouldyou have for a down payment at the end of year 3? how do the values of the integral 1 2 q/t compare for a reversible and irreversible process between the same end states? calculate the change in entropy for the vaporization of xe at its boiling point of -107 c given that vaph = 12.6 kj/mol. 1. -0.118 j/k mol 2. -13.2 j/k mol 3. 0.750 j/k mol 4. 75.9 j/k mol