A new health drink has 190% of the recommended daily allowance (RDA) for a certain vitamin. The RDA for this vitamin is 50 mg. How many milligrams of the vitamins are in the drink?

Answers

Answer 1

There is 95mg of vitamins in the drink

Percentages and proportion

If a new health drink has 190% of the recommended daily allowance (RDA) for certain vitamins and the RDA for this drink is 50mg.

The amount of milligrams of the vitamins in the drink is expressed as shown:

A = 190 % of 50mg

A = 1.9 * 50

A = 95mg

Hence there is 95mg of vitamins in the drink

Learn more on percentages https://brainly.com/question/25793394

Answer 2

Answer:

There is 95mg of vitamins in the drink


Related Questions

ricky is a hardworking man who owns 6 hectares of land. in his will,he divided his lot equally among 7 sons. how much land will each of his son receive?
a. 0.68
b. 0.86
c. 68
d. 86 ​

Answers

Question:-

ricky is a hardworking man who owns 6 hectares of land. in his will,he divided his lot equally among 7 sons. how much land will each of his son receive?

a. 0.68

b. 0.86

c. 68

d. 86

Answer:-

Given,

Land owned by Ricky = 6 hectares

No. of sons = 7

Now,

6 ÷ 7 = 0.8571429 or 0.86

Each son will own 0.86 hectares of land. Option b. 0.86 is the answer.

24,761 divided by 24

Answers

Answer:

1031.70833333

Step-by-step explanation:

What is the scale factor k? The hummingbird nectar recipe is 4 cups of
water to every 1 cup of sugar. If I double the recipe, I will need 8 cups of
water and 2 cups of sugar. If I want half of the recipe, I would need 2 cups
of water and 1/2 cup of sugar. What is the scale factor of water to sugar?
k=

Answers

Answer:

2

Step-by-step explanation:

Scale factor of water to sugar=k

So,

k= amount of water/amount of sugar

=4 / 2

= 2 ANS

From a hot-air balloon, Mariana measures a 40° angle of depression to a landmark that's 1165 feet away, measuring horizontally. What's the balloon's vertical distance above the ground? Round your answer to the nearest hundredth of a foot if necessary.​

Answers

Here is the set up:

Let h = balloon's vertical distance.

sin(40°) = h/1165

sin(40°)(1165) = h

748.847565

748.85 feet = h

Done.

The balloon's vertical distance above the ground is 1388.40 feet to the nearest hundredth.

What is division?

The division in mathematics is one kind of operation. In this process, we split the expressions or numbers into the same number of parts.

Given:

From a hot-air balloon,

Mariana measures a 40° angle of depression to a landmark that's 1165 feet away, measuring horizontally.

Let h be the vertical distance.

Use tanθ = perpendicular / base

Here, perpendicular = 1165 feet and base = h and θ = 40°

Substituting the values,

tanθ = perpendicular / base

tan40° = 1165 / h

h = 1165 / tan40

h = 1165 /  0.839095

h = 1388.40059 feet.

h ≈ 1388.40 feet to the nearest hundredth.

Therefore, vertical distance is 1388.40 feet

To learn more about the division;

https://brainly.com/question/13263114

#SPJ5

23x25 = please help ​

Answers

Answer:

575

Step-by-step explanation:

23/4 = 5.75 times 100

Answer:

575

Step-by-step explanation:

23×25=575 so 575 would be your answer

Help help help math math

Answers

Answer:

Slope = 4

Step-by-step explanation:

Change in Y = 4

Change in X = 1

Slope = Δy/Δx = 4/1 = 4

What expression is equivalent to 8t-18-20t+14

Answers

Answer:2(4t-9-10t+7) is answer and for the next it 2(-6t-2)

Find the value for x ​
(x+20) (4x-5)

Answers

Answer:

I think it x=33

Step-by-step explanation:

[tex]x+20+4x-5=180\\5x+15=180\\-15 -15\\5x = 165\\/5 /5\\x = 33[/tex]

Rewrite the following equation in slope-intercept form. 17x − 4y = 20

Answers

Step-by-step explanation:

-4y= -17x+20

4y=17x-20

y= 4.25x-5

Slope intercept form

y=mx+b

[tex]\\ \tt\Rrightarrow 17x-4y=20[/tex]

[tex]\\ \tt\Rrightarrow 17x-20=4y[/tex]

[tex]\\ \tt\Rrightarrow y=17/4x-5[/tex]

why do these sisters have different traits?

Answers

Answer: because dna is  game of chance

Step-by-step explanation: hope it helps

Because there are thousands of different gene codes

A
Hilda has a bank account balance of $1550. Each week, her balance changes by −$82.50. She wants to keep the balance above $395.

How many weeks will Hilda's balance remain above $395?

Select from the drop-down menu to correctly complete the statement.

Hilda's bank balance will remain above $395
Choose...
weeks.

Answers

Step-by-step explanation:

1550 - 395 = 1155

1155 / 82.5 = 14

Answer should therefore be 14 weeks.

Not my usual way of doing this sort of question but I'm interested to see if it's right. Alternatively you can subtract $82.50 from $1550 until/before you reach $395. Do not go below $395 though.

Answer:

K12 Answer

Step-by-step explanation:

Find the inverse of the matrix A=

[4 -5]
[-7 9]

Answers

Answer:

hope this answer is right 71/45

Today, both the soccer team and the basketball tear
had games. The soccer team plays every 3 days and the
basketball team plays every 5 days. When will both
teams have games on the same day again?


SHOW YOUR WORK PLEASE

Answers

On the 15th day

Explanation

You have to find which multiple they have the same and that would be 15

3: 3, 6, 9, 12, 15, 18, 21 and so on
5: 5, 10, 15, 20, 25 and so on

Answer:3 to 5

Step-by-step explanation:i took the quiz

if the length of a cuboid is 60cm and width 40cm and its surface area is 14800cm² find its height

Please Guyz I Want Full Solved Not Just Answer Please ​​

Answers

Answer:

50 cm

Step-by-step explanation:

let x be the heigth we are looking for.

Each rectangle that covers the cuboid is the product of two dimensions [tex](60\cdot40;\ 60x;\ 40x)[/tex]

Since it's a cuboid, we assume opposite sides are equal.

So each rectangle is counted twice:

[tex]Area=2(60\cdot40+60x+40x)=14800[/tex]

Now, we just isolate x:

[tex]60\cdot40+60x+40x=7400\\2400+100x=7400\\100x=5000[/tex]

Answer:50 cm

Suppose a normal distribution has a mean of 79 and a standard deviation of 7. What is P(x ≥ 72)?

A. 0.84
B. 0.975
C. 0.025
D. 0.16

Answers

Approximately 65% of the distribution lies within one standard deviation of the mean, which is to say,

P(72 ≤ x ≤ 86) ≈ 0.65

Normal distributions are symmetric, so the percentage of values one standard deviation below the mean is equal to the percentage of values one standard deviation above the mean.

P(72 ≤ x ≤ 79) = P(79 ≤ x ≤ 86)

but since the sum of these make up P(72 ≤ x ≤ 86), we find

P(72 ≤ x ≤ 79) ≈ 0.65/2 = 0.325

Also due to symmetry, exactly half of the distribution lies to either side of the mean; namely,

P(x ≥ 79) = 0.5

It follows that

P(x ≥ 72) = P(72 ≤ x ≤ 79) + P(79 ≤ x)

P(x ≥ 72) = 0.325 + 0.5

P(x ≥ 72) = 0.825 ≈ 0.84

Answer: 0.84

Step-by-step explanation:

What fraction of one hour (60 minutes) is represented by the following numbers of minutes? Simplify each fraction whenever possible. A sketch of a clock might help you
15 minutes =
20 minutes =

Answers

Answer:

[tex] \frac{1}{4} [/tex]

[tex] \frac{1}{3} [/tex]

Explain how to use the distributive property to find the product (3) (4 1/5) ​

Answers

Answer:

you didn’t answer my question correctly :(

Step-by-step explanation:

Danielle earns a 7.75% commission on everything she sells at the electronics store where she works. She also earns a base salary of $800 per week. How much did she earn last week if she sold $4,700 in electronics merchandise? Round your intermediate calculations and answer to the nearest cent.

Answers

Answer:

1164.25

Step-by-step explanation:

5. Maribel makes bead necklaces. She uses a
ratio of 4:2:3 when threading green, brown and
yellow beads on the wire. How many green and
yellow beads will Maribel use for a necklace
Icontaining a total of 117 beads?

A. 52 green beads; 39 yellow beads

B. 52 green beads; 26 yellow beads

C. 26 green beads; 52 yellow beads

D. 39 green beads; 52 yellow beads

Answers

Answer:

A.  52 green beads; 39 yellow beads

Step-by-step explanation:

See the attachment.  If we take the ratios of 4, 2 , and 3, they add to 9.  The

Green (G), Blue (B), and Yellow (Y) will have 4/9, 2/9 and 3/9 each of the total beads, 117.

G:  52 Beads

B:  26 Beads

Y:  39  Beads

PLEASE SOMEONE HELP ME OH LORD PLEASE I BEG U

Answers

Answer:

It's 30 because there is an average of 30 days in a month and the person has to take 1mg a day for a month

Step-by-step explanation:

Hope this helps

May I get braineist pls?

C. 30 because 1mg every day and there are 30 days in a month

The following graph shows the system of equations?

PLS HELP

Answers

I think it’s the first choice because you start at -2 then you went up 6???

Shen borrowed $8000 at a rate of 17%, compounded quarterly. Assuming he makes no payments, how much will he owe after 6 years?​

Answers

224,640
(8,000*1.17)(6*4) due to quarterly interest
(8,009*1.17)(24)
(9,360)(24)
9,360*24=224,640

Help help math math good luck

Answers

Angle 4 is 101°
Just find the last angle in the triangle and subtract that from 180.
The last angle in the triangle is going to be 180-52-49=79
Now subtract that from 180 since a straight line is 180°.
180-79=101
Also, your hint just says to add the two angles inside the triangle together. 52+49=101. So, there is two ways of doing it

What is the distance between points A and B?
A. 1/3
B. 1/2
C. 1 1/3
D. 1 1/2

Answers

Answer:

A. 1/3

Step-by-step explanation:

From 1 to ___, ____, and 2 is half and half that would be 2 and a half. the only solution would be 1/3

Answer:

boom

Step-by-step explanation:

Find the missing side in the similar figures below

Answers

Answer:

e

Step-by-step explanation:

24*5/3=40

The answer would be E. Trust me on this one

❗NEED HELP ASAP PLEASE ❗

The value of -3 xy, for x= 2 and y= 3, is -18.

True False

Please give an explanation, thank you!!!​

Answers

Answer:

True

Step-by-step explanation:

-3 xy = -18

-3(2)(3) = -18

I am doing Khan Academy and I'm stuck on a question that said " What is another way to make 4.65 ? "
I learned it at school but I still need help on that Question.

Answers

Answer:

[tex]\frac{465}{100}[/tex] or [tex]\frac{93}{20}[/tex]

Step-by-step explanation:

You can always just multiply the by 100/100 to get any number into a fraction form. I am not sure if this is what you were asking, but here you go. Then you can simplify to get 93/20.

You gotta swag it aht twin

Curtis has a board that is 3/4 of a yard long he cuts it to make shelves that are 1/8 of a yard long how many shelves will there be after he cuts the board ?

Answers

The number of shelves would be 6.

The length of the board and the shelves are fractions. A fraction is made up of a numerator and a denominator. An example of a fraction is 1/8. 1 is the numerator and 8 is the denominator.

In order to determine the number of shelves Curtis cut, we would divide the length of the board by the length of each shelf.

Number of shelves = length of the board / length of the shelf

3/4 ÷ 1/8

3/4 x 8 = 6

To learn more about the division of fractions, please check: https://brainly.com/question/25779356

How many pennies dose Michael please help please I need your help please please please please help

Answers

Answer: He has 91, to figure this out count everything in top row which is 13 and then count everything in left row only which is 7 and 13 x 7 is 91

Step-by-step explanation:

hlep me it is easy plssssssssssssss

Answers

Answer:

C. (10 - 2) ÷ 4

Step-by-step explanation:

To determine which expression represent a number that is one fourth as great as 10-2 the following logical reasoning has to be made:

Given that a number is raised that is a quarter as large as (10-2), the result of this mathematical operation must be divided by 4.

Thus, since 10 minus 2 is equal to 8 and 8 divided by 4 gives 2, the division is necessary as a mathematical operation.

So, since the only option that raises a division is option C, that's the correct option.

Other Questions
A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg) Simplify this question Look at the circuit given below. It consists of a cell, a bulb with two terminals X, Y and wires. P, Q, R and S are positions marked. What is the direction of the flow of current? a) PQXYRS b) SRYXQP c) SPQXYR d) PSRYXQ WILL REPORT WRONG OR TROLL ANSWERS Which word in the passage most clearly shows the speaker's bias against the candidate? Senator Roberts has no experience as a county commissioner, and she is clearly hopeless. A. commissioner B. clearly C. hopeless O D. experience SUBMIT how long does it take from the time beans are planted until they are harvested Help help help please pelsss please You are pulling a child in a wagon. The rope handle is inclined upward at a 60 angle. The tension in the handle is 20 N.Part AHow much work does the rope do on the wagon if you pull the wagon 200 m at a constant speed? how to solve the following system y=(1/2)x^2+2x-1 and 3x-y=1 1. All the computer has a power button.