a conscientious objector refuses to engage in combat because he cannot support the taking of human life. his reasoning best illustrates which stage in lawrence kohlberg’s theory of moral development?

Answers

Answer 1

Answer:

Postconventionalism

Explanation:


Related Questions

responding to a substance like a sugar pill as if it were a drug is called

Answers

Answer: The Placebo effect

Explanation: A placebo is a pill that seems like it is a medical treatment pill but it isn't. Since this question refers to a response it is the placebo effect.

The response to a substance like a sugar pill as if it were a drug is called the placebo effect. A placebo is a drug that looks and acts like a prescribed medication but is not.

What is Health?

The World Health Organization defines health as a condition of complete physical, mental, and social well-being, rather than only the absence of sickness and disability. Over time, several definitions have been utilized for various purposes.

A person may occasionally react to a placebo. The reaction could be favorable or unfavorable. For instance, the patient's symptoms could get better. Or the patient can experience symptoms that seem to be related to the medication. The "placebo effect" is the name given to these reactions.

Therefore, This question is about the placebo effect because it relates to a response.

Learn more about healthy here:

https://brainly.com/question/28290036

#SPJ6

how long do you have to pay spousal support in california?

Answers

Answer-  Depends on the legnth of the marriage.

Explanation:

If a marriage lasts 10 years or longer then spousal suppourt, a.k.a. alimony, is required for the rest of the spouses life. If it is under 10 years then there must be payment for double the amount of time the marriage lasted. Aside from this rule, there are exceptions such as prenups which usually disclose pre-set rules for divorce. There is also the chance there is a fault in the divorce such as infidelity which depending on the case causes less payment to none at all.

Operant conditioning is a learning process in which subjects learn to associate __________. A. Their own behaviors with specific consequences B. Unconditioned responses with conditioned stimuli C. The actions of others with their own responses D. Unconditioned stimuli with conditioned responses Please select the best answer from the choices provided A B C D.

Answers

The correct word for the blank is their own behaviours with specific consequences.

What is operant conditioning?

Operant conditioning aids the individual to develop an understanding of the behaviour and its consequences.

It is a process or the activity of learning that comes by the punishment or giving rewards in the particular behaviour of the individual.

Operant conditioning form of learning is best in the situation when a specific behaviour is punished and rewarded.

Negative and positive reinforcement, and negative and positive punishment, are the primary principles of operant conditioning learning.

Therefore, the correct option is A.

Learn more about operant conditioning here:

https://brainly.com/question/9055153

how were conquered peoples treated by the muslim empire

Answers

Answer:

Explanation:

The people conquered by the Muslims usually faced a choice. They could denounce their religion and convert to Islam, pay a tax to continue practicing their beliefs, become a slave, or be executed. Most chose to convert. Those who paid the religious tax were called dhimmis.

brainliest plz

what is a common name for an epinephrine auto-injector?

Answers

Answer:

Adrenalin......................

Answer:

Explanation:

Epinephrine (EpiPen, EpiPen Jr, Adrenaclick, Auvi-Q, Symjepi, or generic versions of the epinephrine auto-injector) is the first-line treatment for anaphylaxis  

Adrenalin® (epinephrine injection, USP) is a clear, colorless, sterile solution containing 1 mg/mL (1:1000) epinephrine, packaged as 1 mL of solution in a single-use clear glass vial or 30 mL of solution in a multiple-dose amber glass vial.

In which situation democracy handles social diversities?What are relations between them?​

Answers

8 the answer would be approximately 7 feet layers to the ground above the awarefewt

Answer:

Democracy accommodates social diversity as it allows for equality, fair representation to all irrespective of their caste, creed, color, race, religion, language or place of residence. Skin color basically goes with race.

Explanation:

What would happen if there would be no judiciary

Answers

The Constitution of the United States establishes the judicial branch and defines many of the rights the judiciary protects. Congress passes laws, and the president and the executive branch make recommendations and set policy. ... Without the justice system, democracy might easily veer off course.

the cognitive development of children proceeds through several stages. which theorist is most associated with them?

Answers

Piaget may be best known for his stages of cognitive development. Piaget discovered that children think and reason differently at different periods in their lives.

properly aligned low beam headlights maximum safe speed is _____ mph based on your ability to stop within the lighted area.

Answers

Answer:

Low beam headlamps are only effective for speeds up to 20-25 MPH. You must use special care when driving faster than these speeds, since you are unable to detect pedestrians, bicyclists and others.

Explanation:

Explain the roles of civil society in the transformation of society. ​

Answers

Answer:

Civil society organizations give voice to the disorganized, voiceless segments of society. They raise awareness of social issues and advocate for change, empowering local communities to develop new programs to meet their own needs. Ensuring good governance

Explanation:

responding to a driving incident with violence is called

Answers

Road rage is when a driver responds to a road incidence with violence.

Road rage refers to violent behavior exhibited by a driver, usually caused by other bad driving or stress of being in heavy traffic.

Usually, the driver with high-anger does engage in road-rage, including hostile action, revenge etc

In conclusion, the term called "Road rage" is when driver responds to a road incidence with violence.

Read more about Road rage

brainly.com/question/24881685

What point of view does the author use to tell the story? Use details from the story to support your answer

Answers

Answer:

i didn't understand the question

HELPPPP!!! A high school student gives a speech to the entire student body. In the speech, he uses vulgar language and insults. The principal cuts the speech short and suspends the student for a week. The student files a case against the school, claiming that his First Amendment rights had been violated.

In your opinion, were the student’s First Amendment rights violated? If so, how so? If not, why not? Write a paragraph explaining your position. Justify your response with evidence from this tutorial and/or outside research.

Answers

Answer:

the student’s First Amendment rights violated yes bc the first amendment is freedom of speech....it doesn't have to be nice.... it says "Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of speech, or of the press; or the right of the people peaceably to assemble, and to petition the Government for a redress of grievances." it says nowhere in there that the freedom of speech had to be nice.

Explanation:

Answer:

Explanation:

yes, his first amendment rights WERE violated, but for good reason. he was insulting everybody in the room. he deserved the punishment he got for speaking so harshly in front of the entire student body and principals. While his rights were violated, he should not win this case against the school as they did the right thing.

the most common patterns of minority treatment include assimilation, segregation, subjugation, and legal protection.

Answers

Answer:

that is true

Explanation:

Answer:

t

Explanation:

Can some one help me please

Answers

Answer: B i want to say

Explanation:

Answer:

A - Imperialism

Explanation:

World power hat and smoke that says expansion


Prior to the Battle of Yorktown, George Washington planned to

Answers

Answer:

He would fool Clinton into thinking the Continentals were planning to attack New York while instead sneaking away to the south to attack Cornwallis

Explanation:

Answer:

“He would fool Henry Clinton into thinking the Continentals were planning to attack New York while instead sneaking away to the south to attack Cornwallis,”

Explanation:

what title do we assign to groups of three or more young, male vocalists who sing and dance? these groups gained much attention and fame in the 1990s and continued in popularity in the 2000s.

Answers

The title given to groups of three or more young singers who sing and dance is boy band, which were very successful in the 1990s and 2000s.

The boy bands were bands that most members did not play musical instruments, but their performances were marked by choreographies that gave them great performances and a great appeal among young people and teenagers around the world.

Some famous boy bands from the 2000s were:

Backstreet boysN'SyncWestlifeOne direction

Boy bands often sang pop songs with themes about love and relationships, reaching chart tops such as Billboard.

Find out more information about boy bands here:

https://brainly.com/question/10299415

how was education viewed in the new rome

Answers

Answer:of wealth and privilege. only the rich could afford to send their kids to school.

Explanation:

Answer the following questions: 1. What are ethical values? How do these help character formation? 2. Mention any five virtues that can be regarded as universal virtues. 3. Manners are social behaviors that help us build and strengthen relationship. Describe.​

Answers

Answer:

1. ethica value are something thats valuable

2. Look it. up

3. give examples

Explanation:

Why might pork barrel spending be popular with constitution?
Plz help meeee

Answers

Answer:

Pork barrel, or simply pork, is a metaphor for the appropriation of government spending for localized projects secured solely or primarily to bring money to a representative's district. The usage originated in American English. Scholars use it as a technical term regarding legislative control of local appropriations.

Carry learning!

Study hard!

Stay safe!

Brainliest pls!

amaia has been very careful to work with her team to finalize next year’s goals. she has taken the process seriously and now wants to make sure that others do their part. amaia is insisting that all employees follow instructions fully and completely. amaia seems to be exhibiting the:

Answers

Considering the description given above, Amaia seems to be exhibiting Control.

What is Control in Management?

Control in Management is part of the management functions in which the managers ensure the job is done according to plan without errors or deviation from the organization's objective goals.

Therefore when Amaia wants to ensure that others do their part and insist that all employees follow instructions thoroughly and ultimately, this is an example of the Control function.

Hence, in this case, it is concluded that the correct answer is Control.

Learn more about the Control function here: https://brainly.com/question/25453419

the element of the psyche that might make you feel guilty if you steal your little sister’s allowance is your:

Answers

if you steal your little sister's allowance is your action's right?  if its not the right way to do it then way you can do it in the normal way for example: giving back something that you stole from her or the hard or problem way which is for example saying that it was yours even tho not. If you feel guilty  about doing it you should apologize.

What does this demand curve demonstrate?
Demand increases as prices decrease.
Demand increases as prices increase.
Prices decrease as demand decreases.
Prices remain the same as demand increases.

Answers

Answer:

Demand increases as prices decrease.

Explanation:

You failed to provide the image of the demand curve so I will pick what a generic demand curve demonstrates.

The best demonstration that the demand curve shows based on the options is Demand increases as prices decrease.

What is shown by the demand curve?

The law of demand posits that when the price of a good or service decreases, the demand for that good will increase.

The demand curve is a graphical representation of this law. When prices are plotted against quantity demanded, lower prices will lead to higher quantity demanded.

This is why the demand curve is downward sloping.

In conclusion, option A is correct.

Find out more on the law of demand at https://brainly.com/question/10782448.

What is a reason time lines are organized chronologically?

Answers

Answer:

the exact order the events happened helps people understand the cause and effect of those events

DNA contains all the traits that we inherit from our parents.True or false

Answers

False cos I have ADHD and my mom doesn't

Answer:

False i think (sorry if im wrong)

Explanation:

Since you have your own DNA

what is the difference between social security and supplemental security income?

Answers

answer: ssi benifits are payed at the first of the month Also ssi benifits are not based On prior work or family members prier work.

Explanation:

Our physical energy isn't connected to what we eat when we're young because we're just so energetic anyway.
True
False

I need help ASAP!!!

Answers

Answer:

False

Explanation:

Sorry I'm late but if this answer is right I hope it can help someone else!

PLZ I NEED HELP 18 POINTS

Which of these was NOT a goal of the Spanish conquistadors?

converting indigenous people to Christianity

gaining fame and glory by conquering new lands for Spain

searching for gold and other valuable metals

finding a sea route to the East Indies

Answers

Answer:

A converting indigenous people to Christianity

how many senators are needed to impeach the president

Answers

The Constitution requires a two-thirds supermajority to convict a person being impeached. *Idea*

i got a few questions on the black codes and the jim crow laws.

how are they different?
how are they similar?
what did they seek to achieve?
what are some examples of jim crow laws?
what are some examples of black codes?

Answers

Answer: Marriages between African Americans and Native Americans were also prohibited. Establishment of segregated libraries for different races was authorized. All schools were required to be racially segregated. There were to be separate but equal accommodations for whites and African Americans provided in nursing homes.

Explanation:

Other Questions
A town has two shopping malls. A survey conducted on the shopping preferences of the town's residents showed that 62% of the residents visit Comet Mall, 73% of the residents visit Star Mall, and 48% of the residents visit both malls. The probability that a resident is chosen at random shops at either Comet Mall or at Star Mall is Help me pleaseeeeeeeeeee AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA {(23,4),(-3,8),(-25,-21),(20,13),(21,-14)} what is the domain and range Accelerated mammary gland development in intellectually disabled. What is the product of 44(4-7)(4)?-16O-1 -12-1008DONE Determine the intercepts of the line. I will give brainliest Imagine you own a company that makes YOUR FAVORITE PRODUCT. Read the excerpt from a text about online learning. "Virtual schools were growing quite quickly," said Christina Martin, a policy analyst at the Cascade Policy Institute, a free-market think tank based in Portland, Ore. . . . The big issue, she said, was fairness. Some students have access to virtual schools because they have a learning coach to stay home with them, while others dont. Also, Internet connections can be costly, and not every family has one. And families have to pay for their own printing. . . . "An adult must stay with a child during the day and make sure theyre doing their work. " This information would best support a claim about students need for personal coaches. Internet supervision. High-tech gadgets. Equal access to technology. (PHOTOGRAPHY) Rebecca is planning to take photographs on her trip to see the California redwoods. The California redwoods are very, very large trees. She wants to make sure that everyone who sees her photographs understand how giant the trees are. What might she do to help her audience see the scale of the redwoods?Group of answer choicesAsk her parents to park their car near the base of the tree so that it will be in the photograph, too.Take a closeup of the trees bark so viewers get a sense of the level of detail the tree has.Take a photo with more than one redwood tree in the frame.Position herself so that she captures the sky and clouds behind the redwood tree.PLEASE HELP ASAP if the telephone was invented in 1876 how old was it in 1991 how long had it been around 5. My classmate will ask questions to our teacher nor plz help me..In my town, the Chinese Cultural Center offers language lessons on Saturday mornings from 9 to noon. My parents were born in China, but I wasnt. My parents were educated in a Chinese language called Mandarin, but I go to a school where we all speak English. As a result, my family worries that even if we speak Chinese together at home (and we usually do), I might not truly understand our culture or learn how to read or write enough Chinese characters to be literate and fluent.The narrator's parentsI. were born in ChinaII. spoke Mandarin at schoolIII. never learned EnglishAI onlyBII onlyCI and II onlyDI, II, and III In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction Divide 63.5 0.25 round the quotient to the nearest ten-thousandth PLZZZZZZZZZ HELPABC Order and Definitions1.React2.Shift3.Specify4.Thesis5.audience6.format7.purpose8.introduction9.focus10.conclusion11.influence12.fleeting13.mentorship14.normal15.participate16.positive17.circumstantial18.emotional19.contagion20.fleetingABC Order and DefinitionsWrite down 45 affixes containing the sufffix:-or-ment-ness 1/3 of 3 please help I'll give 20 points You want to be able to withdraw $30,000 from your account each year for 15 years after you retire. If you expect to retire in 25 years and your account earns 6.4% interest while saving for retirement and 5.6% interest while retired:Round your answers to the nearest cent as needed.a) How much will you need to have when you retire?$ 448,704.35 (correct answer) b) How much will you need to deposit each month until retirement to achieve your retirement goals?c) How much did you deposit into you retirement account?d) How much did you receive in payments during retirement?e) How much of the money you received was interest? Jacob sells lemonade at a park. His cost to sell the lemonade is a one-time fee for the table,plus a fixed cost to make each cup of lemonade. The line shows the total cost, y, for 3 cupsof lemonade.vCost of Selling LemonadeUseyAy605040Cost ($)302010 X01050203040Number of Cups