a circle has a diameter of 18. the sector has a central angle of 30 degrees. what is the area of the sector?

Answers

Answer 1

Answer:

21.21

Step-by-step explanation:

Area of a circle is A = π r^2

Variables:

r = 18/2 = 9

θ = 30 deg

Find the area:

A = π r^2

A = π 9^2

A = 254.47

Find the area of the sector:

θ/360 * A

= 30/360 * 254.47

= 21.21

Please mark brainliest if this helped!

Please mark brainliest if this helped!


Related Questions

In a two-way between subjects ANOVA, a significant main effect for B means that

A - the mean for B1 is not equal to the mean for B2.

B - the difference between A1 and A2 is not the same at B1 as for B2.

C - the mean for A1 is equal to the mean for A2.

D - the mean for B1 is equal to the mean for B2.

Answers

In a two-way between subjects ANOVA, a significant main effect for B means that option A - the mean for B1 is not equal to the mean for B2.

In a two-way ANOVA, we are examining the effects of two independent variables (factors) on a dependent variable. One of the factors is referred to as factor A, and the other as factor B. A main effect for B indicates that there is a significant difference between the means of the levels of factor B. Therefore, if we observe a significant main effect for B, it implies that the mean for B1 (one level of factor B) is not equal to the mean for B2 (another level of factor B). This suggests that the variable represented by factor B has a significant influence on the dependent variable, and there is a difference in the outcome between the two levels of factor B.

learn more about variables  here:

https://brainly.com/question/26576272

#SPJ11

Question: Find the M

Answers

Answer:

<ABC = 17

Step-by-step explanation:

I'm going to make a guess. My guess is that you want the measure of angle B.  I didn't see that the diagram asks that very question.

If you join <ADC, that angle is also 34 degrees. By the property of angles touching the circumference of a circle, the angle touching the circumference is 1/2 the central angle

1/2 34 = 17

CAN SOMEONE PLEASE HELP ME PLEASE

Answers

Answer:

If Then proof has been explained below!

Step-by-step explanation:

1.) If segment XY ║ ZW, then the 154° angle ≅ ∠2 (vertical angles)

2.) If segment XY ║ ZW, then ∠2 is complementary to ∠4

3.) If ∠2 is complementary to ∠4, then ∠4 = 28°

I hope this helps! If you have any questions, feel free to add it into the comments and please rate my answer and consider marking as brainliest!

I dont know the answer please help me yall

Answers

Answer:

180 customers made additional purchases

Step-by-step explanation:

In order to find the percent of something like 72% of 250 you need to convert the percentage to a decimal and multiply it to the number.

0.72 * 250 = 180

Answer:

180 customers

Step-by-step explanation:

Since 72% of the customers made additional purchases and there were 250 customers, we need to look for 72% of 250. To do this we convert 72 into a fraction, which makes it 0.72 and we turn the word "of" into a multiplication symbol (as of most commonly means multiplication in math). So, 0.72*250=180. Therefore, 180 customers made additional purchaces.

A coastline recedes at a rate of 3cm per year. How much of the coastline dissappears after 4 years?

Answers

Answer:

12 cm of coastline

Step-by-step explanation:

Multiply the years (factor) by the receding amount, 3cm, (constant) BAM answer.

pls HeLp meee and tyy

Answers

Answer:

Step-by-step explanation:

The rectangular prism has a volume of 936 cubic inches. Write and solve an equation to find the missing dimension of the prism.

Answers

Answer: Solution in photo

A whale is at the surface of the ocean to breathe. What is the whale's elevation?

Answers

0 because it’s at the surface

PLEASE HELP! What does x equal?

Answers

Step-by-step explanation:

(FE+BC)/2=<FDE

<FDE=<BDC

it is basically the average of x and 70.

(x+70)/2=104

x=138

Hope that helps :)

Answer:

The answer is probly 70 degrees

i might be wrong

i just hope this works

good luck

Write the word sentence as an equation. 12 less than a number m equals 20.

Answers

Answer:

12 - m = 20

Explanation: Less than can also be a subtraction symbol so 12 less than a number, which the number is unknown in this case would be replaced with m then equals to 20. 12 - m =20

bob is pulling a 30 kgkg filing cabinet with a force of 200 nn , but the filing cabinet refuses to move. the coefficient of static friction between the filing cabinet and the floor is 0.80.

Answers

Bob is exerting a force of 200 N on a 30 kg filing cabinet, but it remains stationary due to the static friction between the cabinet and the floor. The coefficient of static friction is given as 0.80.

The static frictional force acts between two surfaces in contact when there is no relative motion between them. The magnitude of static friction can be determined using the equation F_static = μ_static * N, where μ_static is the coefficient of static friction and N is the normal force.

In this scenario, Bob is applying a force of 200 N to the filing cabinet. In order to overcome the static friction and set the cabinet in motion, the applied force must be greater than or equal to the maximum static frictional force. The maximum static frictional force can be calculated by multiplying the coefficient of static friction with the normal force.

Since the cabinet is stationary, the applied force of 200 N is not sufficient to overcome the maximum static frictional force. The maximum static frictional force can be determined as F_static = μ_static * N = 0.80 * (30 kg * 9.8 m/s^2) = 235.2 N.

As the applied force of 200 N is less than the maximum static frictional force of 235.2 N, the filing cabinet remains stationary. Bob would need to apply a force greater than 235.2 N to overcome the static friction and set the cabinet in motion.

Learn more about coefficient here:

https://brainly.com/question/1594145

#SPJ11

The expression shown below was generated using a graphing calculator. Solve the expression and answer in correct scientific notation.
(4.5E6)(2.3E7)
A) 1.035×1014
B) 1.035×1013
C) 6.8×1013
D) 2.2×1013

Answers

The answer to your question is D

An experiment consists of tossing 3 fair (not weighted) coins, except one of the 3 coins has a head on both sides. Compute the probability of obtaining exactly 3 heads The probability of obtaining exactly 3 heads is

Answers

The probability of obtaining exactly 3 heads is 5/16.

We can find the probability of obtaining exactly 3 heads by considering the different ways in which this can happen.

First, suppose we toss the two normal coins and the biased coin with the two heads.

There is a probability of getting heads on each toss of the biased coin: 1/2

A  probability of getting heads on each toss of the normal coins: 1/2

Therefore, the probability of getting exactly 3 heads in this case is:

(1/2) * (1/2) * (1/2) = 1/8

Now suppose we toss the two normal coins and the biased coin with the two heads, but we choose to use the biased coin twice. In this case, we need to get two heads in a row with the biased coin, and then a head with one of the normal coins.

The probability of getting two heads in a row with the biased coin is: 1/2, and the probability of getting a head with one of the normal coins is: 1/2. Therefore, the probability of getting exactly 3 heads in this case is:

(1/2) * (1/2) * (1/2) = 1/8

Finally, suppose we use the biased coin and one of the normal coins twice each. In this case, we need to get two heads in a row with the biased coin, and then two tails in a row with the normal coin. The probability of getting two heads in a row with the biased coin is: 1/2,

and the probability of getting two tails in a row with the normal coin is :

(1/2) * (1/2) = 1/4.

Therefore, the probability of getting exactly 3 heads in this case is:

(1/2) * (1/2) * (1/4) = 1/16

Adding up the probabilities from each case, we get:

1/8 + 1/8 + 1/16 = 5/16

Therefore, the probability of obtaining exactly 3 heads is 5/16.

Learn more about Probability of tossing coins :https://brainly.com/question/22789432

#SPJ11

What is the approximate surface area of this right prism with triangular bases?

Answers

Answer:

394.2 ft

Step-by-step explanation:

7.8(9)=70.2

This is the measurement for the two triangular sides

9(12)(3)=324 This is the measurement for the three triangular sides

70.2 +324 = 394.2 APPROX

Pennies made prior to 1982 were made of 95% copper Because of their copper content, these pennies are worth about $0.023 each. Pennies made after 1982 are only 2.5% copper Jenna reads online that 13.2% of pennies in circulation are pre-1982 copper pennies. Jenna has a large container of pennies at home. She selects a random sample of 50 pennies from the container and finds that 11 are pre-1982 copper pennies Does this provide convincing evidence that the proportion of pennies in her container that are pre-1982 copper pennies is greater than 0.132?

a. Identify the population, parameter, sample and statistic.
Population:________ parameter_________
Sample_________Statistic:__________
b. Does Jenna have some evidence that more than 13.2% of her pennies are pre-1982 copper pennies?
c. Provide two explanations for the evidence described in #2.

Answers

a)

Population: All pennies in the containerParameter: p = Proportion of pre-1982 copper pennies in the containerSample: 50 randomly selected pennies from the containerStatistic: Number of pre-1982 copper pennies in the sample = 11

b) If the test statistic is greater than the critical value, we can reject the null hypothesis and conclude that there is evidence that the proportion is greater than 0.132.

c. Two possible explanations for the evidence that Jenna found are given below.

Solution:

a.

Identify the population, Parameter, sample, and statistic.

Population: All pennies in the container

Parameter: p = Proportion of pre-1982 copper pennies in the container

Sample: 50 randomly selected pennies from the container

Statistic: Number of pre-1982 copper pennies in the sample = 11

b.

To determine if Jenna has convincing evidence that more than 13.2% of her pennies are pre-1982 copper pennies, we can perform a hypothesis test.

Let's assume that the null hypothesis is that the proportion of pre-1982 copper pennies in the container is equal to 0.132, while the alternative hypothesis is that the proportion is greater than 0.132.

Then, we can calculate the test statistic and compare it to the critical value.

If the test statistic is greater than the critical value, we can reject the null hypothesis and conclude that there is evidence that the proportion is greater than 0.132.

c. Two possible explanations for the evidence that Jenna found could be:

1. The container has a higher proportion of pre-1982 copper pennies than the national average.

2. Jenna's sample is not representative of the container, and the sample proportion is higher than the population proportion by chance.

To know more about hypothesis test, visit:

https://brainly.com/question/30404845

#SPJ11

What does the best fit line estimate for the y value when x is 100

Answers

you can’t estimate a variable if the letter has no meaning, you cannot do this problem w this information

The best fit line estimate for the y value when x is 100 in this case is 205.

What is Equation?

Two or more expressions with an Equal sign is called as Equation.

To determine what the best fit line estimate for the y value is when x is 100.

Assuming that you have a linear regression model with the equation y = mx + b, where "m" is the slope and "b" is the y-intercept, you would need to know the values of "m" and "b" to estimate the y value for a given x value.

If you have these values, you can substitute x = 100 into the equation and solve for y.

The resulting value will be the estimated y value for the given x value.

If the equation of the best fit line is y = 2x + 5, then the estimated y value when x is 100 would be:

y = 2(100) + 5

y = 200 + 5

y = 205

Hence, the best fit line estimate for the y value when x is 100 in this case is 205.

To learn more on Equation:

https://brainly.com/question/10413253

#SPJ2

Your grandmother always has a jar of cookies on her counter. One day while you are visiting, you eat 5 cookies from the jar. In the equation below, c is the number of cookies remaining in the jar and b is the number of cookies in the jar before your visit.

Answers

Answer:

b - 5 = c

Step-by-step explanation:

if you take the number of cookies before the visit (B) and then you eat 5, that would be (B - 5). after you eat the cookies, C is the amount left. so it’s a subtraction problem without 2 numbers. so the equation would be

b - 5 = c

or

before - 5 = after

determine the inteerval on which the following function is convave upor concave down. identify any inflection points. f(x)= x^4-4x^3 3

Answers

To determine the intervals on which the function [tex]f(x) = x^4 - 4x^3 + 3[/tex] is concave up or concave down, we need to find the second derivative of the function and analyze its sign.

First, let's find the first derivative of f(x):

[tex]f'(x) = 4x^3 - 12x^2[/tex]

Next, let's find the second derivative of f(x) by taking the derivative of f'(x):

[tex]f''(x) = 12x^2 - 24x[/tex]

To determine the intervals of concavity, we need to find where f''(x) is positive (concave up) or negative (concave down). We can do this by analyzing the sign of f''(x).

Now, let's find the values of x for which f''(x) = 0, as these will give us potential inflection points:

[tex]12x^2 - 24x = 0[/tex]

12x(x - 2) = 0

x = 0 or x = 2

The potential inflection points are x = 0 and x = 2.

To analyze the concavity of the function, we'll use test points within the intervals between the potential inflection points and beyond.

For x < 0, let's choose x = -1 as a test point:

[tex]f''(-1) = 12(-1)^2 - 24(-1) = 12 + 24 = 36[/tex]

Since f''(-1) = 36 > 0, the function is concave up for x < 0.

For 0 < x < 2, let's choose x = 1 as a test point:

[tex]f''(1) = 12(1)^2 - 24(1) = 12 - 24 = -12[/tex]

Since f''(1) = -12 < 0, the function is concave down for 0 < x < 2.

For x > 2, let's choose x = 3 as a test point:

[tex]f''(3) = 12(3)^2 - 24(3) = 108 - 72 = 36[/tex]

Since f''(3) = 36 > 0, the function is concave up for x > 2.

In summary:

The function is concave up for x < 0 and x > 2.

The function is concave down for 0 < x < 2.

The inflection points are x = 0 and x = 2.

I hope this clarifies the concavity and inflection points of the given function. Let me know if you have any further questions!

Learn more about concave and convex function here:

https://brainly.com/question/30340316

#SPJ11

Find the inverse of the following matrix. Write entries as integers or fractions in lowest terms. If the matrix is not invertible, type "N" for all entries. -5-1021 A = -2-5 9 1 2 -4

Answers

The inverse of matrix A is given by;

A^-1 = |5/139   -189/139 29/139 |

         |-10/139 129/139 -27/139 |
         |-5/139   19/139 -3/139  |

The given matrix is A =

| -5  -10  21 |
| -2   -5   9 |
|  1    2  -4 |

To find the inverse of a matrix, first find the determinant of that matrix. The determinant of matrix A is given as;

|A| = -5(-5(-4) - 2(9)) - (-10)(-2(-4) - 1(21)) + (21)(-2(2) - 1(-5))

|A| = -5(10) + 100 - 21(9)

|A| = -50 + 100 - 189

|A| = -139

Thus, the determinant of matrix A is -139. Now, we can use the formula of inverse of a 3x3 matrix;

A^-1 = 1/|A| * |(b22b33 - b23b32)  (b13b32 - b12b33)  (b12b23 - b13b22)|
| (b23b31 - b21b33)  (b11b33 - b13b31)  (b13b21 - b11b23)|
| (b21b32 - b22b31)  (b12b31 - b11b32)  (b11b22 - b12b21)|

where b is the cofactor of each element of matrix A.

The cofactor of element aij is denoted as Aij and given as Aij = (-1)i+j|Mij|.

Thus, the cofactors of matrix A are;

|-5  -10  21|
| -2  -5  9 |
|  1   2 -4 |

M11 = | -5  9 |
         |  2 -4 |

M12 = | -2  9 |
          |  2 -5 |

M13 = | -2 -5 |

M21 = | -10 21 |
         |   2 -9 |

M22 = |  -5 -21 |
           |  -2  5 |

M23 = |  -2 -2 |

M31 = | -10 -5 |
         |  2  9 |

M32 = |  -5 -9 |
          |  2  2 |

M33 = |  -2 -2 |

Now we can find the inverse of matrix A as follows;

A^-1 = 1/-139 * |(5   189  -29)|
                      |(-10 -129  27)|
                      |(-5   19  -3) |

Hence, the inverse of matrix A is given by;

A^-1 = |5/139   -189/139 29/139 |

         |-10/139 129/139 -27/139 |
         |-5/139   19/139 -3/139  |

To learn more about matrix

https://brainly.com/question/28180105

#SPJ11

find the LCM lowest common multiple and the HCF highest common factor of 40 and 56

Answers

Answer:

280 and 8

Step-by-step explanation:

the LCM is the lowest common multiple

the lowest multiple that can Divide 40 and 56 without a remainder = 280

the Hcf Is the highest common factor of 40 and 56

the highest number that can Divide both =8

2. Translate the sentence to function notation:
The cost of shipping depends on the distance shipped.

Answers

Answer:

see the explanation below

Step-by-step explanation:

The expression for the cost can be given as

y=mx+c

where x= the distance

           m= the cost to move x distance

            c= the fixed cost

Therefore the total cost to ship the cost will be y

4) Of all the registered automobiles in Colorado, 10% fail the state emissions test. Ten automobiles are selected at random to undergo an emissions test. a. Find the probability: (Provide your answer with three decimal places) 1) That exactly three of them fail the test. [2 pts] 11) That fewer than three of them fail the test. [3 pts] 1) That at least eight of them fail the test. [3 pts] b. Find the mean, variance, and standard deviation of the number of automobiles fail the test. (Round your answers to three decimal places if needed) (5 pts]

Answers

The mean is 1, variance is 0.9, and standard deviation is 0.948, rounded to three decimal places. Given data: Of all the registered automobiles in Colorado, 10% fail the state emissions test.

Ten automobiles are selected at random to undergo an emissions test.a. Find the probability:

1) That exactly three of them fail the test.

For the number of success (x) and number of trials (n),

the probability mass function (PMF) for binomial distribution is given by: [tex]P(X = x) = C(n, x) * p^{(x)} * q^{(n-x)},[/tex]

where [tex]C(n, x) = (n!)/((n-x)! * x!) ,[/tex]

p and q are the probabilities of success and failure, respectively. Here, the probability of success is the probability of an automobile to fail the test, p = 0.10 and the probability of failure is q = 1 - p = 0.90.

Now, X is the number of automobiles that fail the test.

Thus, n = 10, x = 3, p = 0.10, and q = 0.90.

Using the above formula:

[tex]P(X = 3) = C(10, 3) * (0.10)^{(3)} * (0.90)^{(10-3)}\\= 0.057[/tex]

The required probability is 0.057, rounded to three decimal places.

1) That fewer than three of them fail the test.

The required probability is P(X < 3).P(X < 3) = P(X = 0) + P(X = 1) + P(X = 2) Using the above formula:

[tex]P(X = 0) = C(10, 0) * (0.10)^{(0)} * (0.90)^{(10)}[/tex]

= 0.3487P(X = 1)

= [tex]C(10, 1) * (0.10)^{(1) }* (0.90)^{(9)}[/tex]

= 0.3874P(X = 2) = [tex]C(10, 2) * (0.10)^{(2)} * (0.90)^{(8)}[/tex]

 = 0.1937

Now, P(X < 3) = P(X = 0) + P(X = 1) + P(X = 2)

= 0.3487 + 0.3874 + 0.1937

 = 0.9298

The required probability is 0.9298, rounded to three decimal places.

1) That at least eight of them fail the test.

The required probability is

P(X ≥ 8).P(X ≥ 8) = P(X = 8) + P(X = 9) + P(X = 10) Using the above formula:

[tex]P (X = 8) = C(10, 8) * (0.10)^{(8)} * (0.90)^{(2) }[/tex]

= 0.0000049

[tex]P(X = 9) = C(10, 9) * (0.10)^{(9)} * (0.90)^{(1) }[/tex]

= 0.0000001

[tex]P(X = 10) = C(10, 10) * (0.10)^{(10)} * (0.90)^{(0)}[/tex]

= 0.0000000001

Now,

P(X ≥ 8) = P(X = 8) + P(X = 9) + P(X = 10)

= 0.0000049 + 0.0000001 + 0.0000000001 = 0.000005

The required probability is 0.000005,

rounded to three decimal places.

b. Find the mean, variance, and standard deviation of the number of automobiles fail the test.

The mean (μ) for binomial distribution is given by: μ = n * p,

where n is the number of trials and p is the probability of success.

The variance ([tex]= 1 \sigma ^ 2 = n * p * q = 10 * 0.10 * 0.90 ^2[/tex]) for binomial distribution is given by: [tex]\sigma ^2 = n * p * q[/tex]

The standard deviation (σ) for binomial distribution is given by:

σ = √(n * p * q)

Here, n = 10 and p = 0.10.

Thus, q = 0.90.

Using the above formulas:

μ = n * p = 10 * 0.10

[tex]= 1\sigma ^2 = n * p * q = 10 * 0.10 * 0.90[/tex]

= 0.9σ = √(n * p * q)

= √(10 * 0.10 * 0.90)

= 0.948

To know more about standard deviation, visit

https://brainly.com/question/12402189

#SPJ11

Will the following variables have positive correlation, negative correlation,
or no correlation? Number of managers on staff at a restaurant and number
of waiters on staff

Answers

Answer:

Step-by-step explanation:

7.
A customer went to a garden shop and bought some potting soil for $17.50 and 4 shrubs. The total bill was $53.50. Write and solve an equation to find the price of each shrub.


A. 4p + $17.50 = $53.50; p = $9.00

B. 4p + 17.5p = $53.50; p = $2.49

C. 4p + $17.50 = $53.50; p = $11.25

D. 4(p + $17.50) = $53.50; p = $4.00

Answers

Answer:  A. 4p + $17.50 = $53.50; p = $9.00

1:  17.50+4p=  Nothing further can be done with this topic. Please check the expression entered or try another topic.

17.5 + 4 p

2:  4p=53.50-17.50=  4p=53.50-17.50

Step-by-step explanation:  9

The total bill: $53.50

17.50 + 4 x = 53.50

4 x = 53.50 - 17.50

4 x = 36

x = 36 : 4

x = $9

Answer: The price of each shrub is $9.

...............................................................................................................................................

Answer:

$9

Step-by-step explanation:

Let   be the price of each shrub.

4 shrubs at    each costs    dollars

Potting soil is $17.50

Hence, total cost is the expression  

We know that total bill is $53.50, so we can equate it to the expression:

This equation can be solved for    to find cost of each shrub.

Solving for    gives us:

So price of each shrub is $9

Graph y=\dfrac{2}{7}\,xy= 7 2 ​ xy, equals, start fraction, 2, divided by, 7, end fraction, x.

Answers

Answer:

The answer is A, C, and D

The graph should be 7 units for x and 2 units for y.

Step-by-step explanation:

Full Question: Graph y = 2/7x

Look at attachment:

Hope this helps! :)

The graph of the linear function y = (2/7)x will be given below.

What is the graph of the function?

The collection of all coordinates in the planar of the format [x, f(x)] that make up a variable function's graph.

A linear system is one in which the parameter in the equation has a degree of one. It might have one, two, or even more variables.

The equation of line is given as

y = mx + c

Where m is the slope and c is the y-intercept.

The function is given below.

y = (2/7)x

Compare the function with standard equation of the line,

Then the slope of the function is 2/7 and the y-intercept is zero, that means the line is passing through origin.

Then the graph of the linear function y = (2/7)x will be given below.

More about the graph of the function link is given below.

https://brainly.com/question/9834848

#SPJ2

Determine which set of side measurements could be used to form a right triangle.
12, 16, 20
6, 14, 19
6, 8, 15
4, 5, 6

Answers

Only the side lengths 12, 16, and 20 can be used to create a right triangle.(Option-A)

The Pythagorean theorem, which states that the square of the length of the hypotenuse (the longest side) is equal to the sum of the squares of the lengths of the other two sides, must be satisfied for a set of side measurements to create a right triangle.

This theorem allows us to determine which sets of side measurements can create a right triangle. 202 = 400 for the set of measures 12, 16, and 20.

[tex]12^2 + 16^2[/tex] = 144 + 256 = 400

The measurements could result in a right triangle because they meet the Pythagorean theorem.

Measurements 6, 14, and 19 are as follows: 192 = 361 62 + 142 = 36 + 196 = 232 . (Option-A)

For such more questions on right triangle

https://brainly.com/question/29869536

#SPJ8

Answer:

12, 16, 20

Step-by-step explanation:

A right triangle is a triangle that has one right angle, which is an angle that measures 90 degrees. The side opposite the right angle is called the hypotenuse. The other two sides are called the legs.

We can use the Pythagorean theorem to determine which set of side measurements. The Pythagorean theorem states that in a right triangle, the square of the hypotenuse is equal to the sum of the squares of the legs.

So, for each set of side measurements, we can calculate the square of each side and add them together. If the sum is equal to the square of the hypotenuse, then the set of side measurements could be used to form a right triangle.

Set 1: 12, 16, 20

Square of 12: 144Square of 16: 256Square of 20: 400

The sum of the squares of the legs is 144 + 256 = 400.

The square of the hypotenuse is also 400.

Therefore, set 1 could be used to form a right triangle.

Set 2: 6, 14, 19

Square of 6: 36Square of 14: 196Square of 19: 361

The sum of the squares of the legs is 36 + 196 = 232.

The square of the hypotenuse is 361.

Since the sum of the squares of the legs is not equal to the square of the hypotenuse, set 2 could not be used to form a right triangle.

Set 3: 6, 8, 15

Square of 6: 36Square of 8: 64Square of 15: 225

The sum of the squares of the legs is 36 + 64 = 100.

The square of the hypotenuse is 225.

Since the sum of the squares of the legs is not equal to the square of the hypotenuse, set 3 could not be used to form a right triangle.

Set 4: 4, 5, 6

Square of 4: 16 Square of 5: 25 Square of 6: 36

The sum of the squares of the legs is 16 + 25 = 41.

The square of the hypotenuse is 36.

Since the sum of the squares of the legs is not equal to the square of the hypotenuse, set 4 could not be used to form a right triangle.

Therefore, the only set of side measurements that could be used to form a right triangle is set 1.

what angle is opposite the longest side?
I will mark as brainliest​

Answers

Answer:

75

Step-by-step explanation:

Answer:

the angle that is 75 degrees

Step-by-step explanation:

Because the longest side is always opposite of the largest angle and the smallest side is always opposite of the smallest angle.

The daily return of the stock XYZ is normally distributed with a mean of 20 basis points and a standard deviation of 40 basis points. Find the probability of making a gain that amounts for more than one standard deviation from the mean on any given day.

Answers

The probability of making a gain that exceeds one standard deviation from the mean for stock XYZ on any given day is approximately 31.73%.

The probability of making a gain that amounts to more than one standard deviation from the mean on any given day for the stock XYZ can be found using the properties of the normal distribution.

To calculate this probability, we need to find the area under the normal distribution curve beyond one standard deviation from the mean in the positive direction. In this case, the mean (μ) is 20 basis points and the standard deviation (σ) is 40 basis points.

Using the standard normal distribution, we can convert the value one standard deviation above the mean (μ + σ) to a z-score by subtracting the mean and dividing by the standard deviation.

Z = (X - μ) / σ

Z = (μ + σ - μ) / σ

Z = σ / σ

Z = 1

Once we have the z-score, we can look up the corresponding probability using a standard normal distribution table or a statistical calculator.

The area under the normal curve beyond one standard deviation from the mean in the positive direction corresponds to approximately 0.1587 or 15.87%.

Therefore, the probability of making a gain that amounts to more than one standard deviation from the mean on any given day for stock XYZ is approximately 0.1587 or 15.87%.

To know more about probability , refer here:

https://brainly.com/question/31828911#

#SPJ11

help pls plssssss now

Answers

Answer:

i would say B but i dont know

Step-by-step explanation:

Compute the first 4 non-zero terms (if any) of the two solutions
linearly independent power series form centered on
zero for the Hermite equation of degree 2, that is y''-2xy'+4y=0

Answers

The power series solutions for the Hermite equation of 2 are zero for the first four terms of the given equation.

Equation = y''-2xy'+4y=0

The solutions can be expressed as power series using the Hermite equation of degree 2 can be calculated as:

y = ∑(n=0 to ∞) [tex]a_n x^{n}[/tex]

where [tex]a_n[/tex] is the coefficient of the nth term and x is the variable.

Differentiating y with regard to x,

y = ∑(n=0 to ∞) [tex]a_n x^{n-1}[/tex]

Double integrating the y with respect to x:

y'' = ∑(n=0 to ∞) [tex]a_nn(n-1)x^{n-2}[/tex]

Substituting the above equation in the Hermite equation

∑(n=0 to ∞) [tex]a_nn(n-1)x^{n-2}[/tex] - 2x∑(n=0 to ∞) [tex]a_n x^{n-1}[/tex] + 4∑(n=0 to ∞) [tex]a_n x^{n}[/tex] = 0

∑(n=0 to ∞)[tex][a_n(n(n-1) - 2n + 4)] x^{n}[/tex] = 0

Taking the coefficients of each term as zero:

[tex]a_n[/tex](n(n-1) - 2n + 4) = 0

The first four non-zero terms:

If n = 0,

[tex]a_o[/tex](0(0-1) - 2(0) + 4) = 0

[tex]a_o[/tex](4) = 0

[tex]a_o[/tex] = 0

If n = 1,

[tex]a_1[/tex](1(1-1) - 2(1) + 4) = 0

[tex]a_1[/tex](2) = 0

[tex]a_1[/tex] = 0

If n= 2,

[tex]a_2[/tex](2(2-1) - 2(2) + 4) = 0

[tex]a_2[/tex](2) = 0

[tex]a_2[/tex]= 0

If n = 3,

[tex]a_3[/tex] (3(3-1) - 2(3) + 4) = 0

[tex]a_3[/tex] (2) = 0

[tex]a_3[/tex]  = 0

Therefore we can conclude that the power series solutions for the Hermite equation of 2 are zero.

To learn more about the Hermite equation

https://brainly.com/question/32620303

#SPJ4

Other Questions
in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key The total population of the United States exceeds 328 million people. Many transactions each day are needed to feed, clothe, and shelter a population of this size. The number is huge. It all works because the US economic system distributes the output of farms and factories. This example shows that ___________. a. marketing is important to business b. marketing dominates supply chain activities c. distribution is the focus of marketing d. distribution is not part of marketing activities select all of the following that would be soluble in the dichloromethane layer of an extraction that utilizes water and dichloromethane as its liquid layers: group of answer choices cyclopentane sodium chloride ethoxypropane methylcyclohexane lithium acetate Which of the following is an example of foreign direct investment in China? A.Chinese Shenzen Airlines company buys a small U.S. midwest airline company, Air Chicago. B.A U.S. foreign exchange speculator buys $200,000 worth of the Chinese currency the yuan. C.U.S. auto entrepreneur Elon Musk buys stock in Alibaba Group Holding Limited of Hangzhou, China. D.The U.S. company Walmart buys a warehouse in Shanghai. E.The bank of China purchases U.S. Treasury bonds. Comment on the significance of each concept in terms of the role it plays in helping us to understand the nature of international economic relations.1. Internal economies of scale.2. A carbon tariff.3. The real exchange rate. Police infotainment tends to privilege which criminal justice frames? T/F. robust australopithecines had large chewing muscles but lacked a sagittal crest. how many moles of NH, will be produced if 3.5 moles of N2, are reacted completely You have configured your switches with the spanning-treevlan x root primary and spanning-tree vlan x rootsecondary commands. Which of the following tertiary switchwill take over if both switches fail?A. A switch with priority 4096B. A switch with priority 8192C. A switch with priority 12288D. A switch with priority 20480 increased collections is a benefit of a multidisciplinary approach to rcm? use the quadratic formula to find the exact solutions of x2 5x 2 = 0. the shoe co. manufactures and sells two lines of shoes. during the most recent accounting period, the black line and the brown line sold 15,000 and 2,000 units, respectively. the company's most recent financial statements are shown below: black brown sales $ 900,000 $ 240,000 less cost of goods sold: unit-level production cost 600,000 135,000 depreciation, production equipment 125,000 50,000 gross margin $ 175,000 $ 55,000 less operating expenses: unit-level selling and administrative costs 40,000 65,000 corporate-level facility expenses (fixed) 36,000 36,000 net income (loss) $ 99,000 $ (46,000 ) based on this information, the company should: a. keep the brown line because it contributes $55,000 to total profitability. b. eliminate the brown line because it is operating at a loss. c. keep the brown line because it contributes $40,000 to total profitability. d. it is impossible to determine with the given information. we need to know the number of products we have in the purchaseorderdetail table. (count the number of un-repeated productid) 8. (5 pts) what is (0.00034) x 48579? make sure the reported answers is rounded properly. a) 16.5 b) 17 c) 16.517 d) 16.52 : In its 2019 annual report, Whirlpool Corporation reported that it had revenues of RM18.1 billion, cost of goods sold of RM15.2 billion, accounts receivable of RM2 billion, inventory of RM2.4 billion, and account payable of RM3.71 billion. (a) Calculate cash conversion cycle Whirlpool Corporation (assuming a 365-day year). (6 marks) (b) Draw a timeline for Whirlpool's operating cycle and cash conversion cycle. your home insurance provides for replacement value for personal property losses. a microwave is stolen. it cost $270 two years ago and has an expected life of six years. a comparable microwave costs $385 today. what amount will the insurance company pay? In t = 0, SpaceY Inc. is an unlevered company whose Beta is 2. The risk free-rate in the economy is 5%, and the market return is 10%. To begin with, assume that capital markets are perfect and Modigliani-Miller (MM) assumptions hold true. Determine the required cost of equity using CAPM. if = 30, sample mean = 28.0, s = 6.1 and n = 13, the value of tobt is _________