28) 6CO2 + 6H20 + (energy) → C6H12O6 + 602
What process is being shown in the chemical equation above?
Help

Answers

Answer 1

Answer:Photosynthesis can be represented using a chemical equation. The overall balanced equation is. ... Learn about the retirement process, managing your existing files, and alternative services at the Andrew File System Retirement Information ...

Explanation:


Related Questions

can all organisms respond to stimuli?

Answers

Answer:

I believe all living organisms can

Explanation:

Yes, all living organisms are able to respond to stimuli in their environment (stimuli= temps, gravity, and lighting)

Which process is best illustrated by the diagram?

Answers

Answer:

Photosynthesis

Explanation:

The formula shown is the one for photosynthesis.  6CO2 + 6H2O → C6H12O6 + 6O2. (please tell me if i am correct) :)

The last universal common ancestor (LUCA) probably multiplied by duplicating all of its cellular contents, followed by cellular division .

Answers

Answer: true

Explanation:

i guessed and got it right

An ideal frictionless machine: O has very little friction O has no friction does not require work input PLEASE HELPP MEEE ​

Answers

Answer:

Has very little friction

Explanation:

If there isn't enough friction stuff can get out of control, but just a little is just right.

Answer:

has no friction

Explanation:

got this correct in my work

Help me ASAP please

Answers

Answer:

C

Explanation:

Joseph and Molly each have coin collections. Joseph starts with 15 coins in his collection and adds 25 coins each month. Molly starts with 25 coins in her collection and adds 25 coins each month. If Joseph and Molly continue to collect in this way, how many coins will each person have after 10 months? Enter your answers in the boxes. After 10 months, Joseph will have coins in his collection, and Molly will have coins in her collection.

Answers

Answer:

Joseph will have 265 coins and Molly will have 275 coins after ten months.

Explanation:

Joseph already has 15 coins and adds 25 coins after each month. So after ten months the total number of coins Joseph will have is [tex]15+25\times 10=265[/tex] coins.

Molly already has 25 coins and adds 25 coins after each month. So after ten months the total number of coins Joseph will have is [tex]25+25\times 10=275[/tex] coins.

So, Joseph will have 265 coins and Molly will have 275 coins after ten months.

describe one piece of evidence represented by the contour line on the map that indicates the north side of chimney bluffs is steep?

Answers

Incomplete question. Attached is the image of the map below.

Explanation:

From the map, we could notice the contour lines around the Chimney Bluff areas are closely packed together. In other words, the spacing between the contour lines is narrower than those found in other locations.

This assertion is accurate because it is a standard practice in many maps to indicate the steepness of an area by having the contour lines in close proximity.

Which are different forms of the same gene?
A.genotypes
B.phenotypes
C.alleles
D.traits

Answers

Answer:

alleles

Explanation:

An allele is a variant form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a chromosome. Humans are called diploid organisms because they have two alleles at each genetic locus, with one allele inherited from each parent.

Answer:

C. alleles

Explanation:

edge 2021

Describe how energy flows through an energy pyramid? Write your answer in the space provided below.

Answers

Answer:

Depending on the food pyramid, on the side there may be something that says decomposers. These eat from all of the sections of the pyramid.

Energy flows from the bottom to the top, and then to the side with the decomposer.

someone Please help!! I'm not good at this stuff. I'll give brailniest

Answers

Answer:

What do you need help with?

Explanation:


Which type of energy
does respiration release?
chemical
thermal
potential
kinetic

Answers

Answer:

Respiration releases energy it is an exothermic process. The energy is stored in molecules of ATP . ATP can be broken down in other processes in cells to release the stored energy.

chemical

describe some of destructive action of microbes ​

Answers

Answer:

A microbe is a small living thing too tiny to be seen by the naked eye and includes bacteria, fungi and viruses. Among their destructive actions is causing diseases in human beings and their livestock or plants, destruction of food by causing decomposition which might lead to hunger and other related calamities. Despite this destructive consequences, microbes are also known to have advantageous actions like helping in sewerage treatment, microbes found in the gastro-intestinal tract help in maintaining a good environment for digestion to take place. Microbes also help in ecological balance by causing decomposition of dead matter hence conserve the environment.

Explanation:

Answer:

see the attached photo

Which is the outcome of a mass of cells in the lungs?

A. The lungs will stop working.
B. This will not affect the lungs.
C. The lung's capacity for oxygen will be positively affected.
D. The lung's capacity for oxygen will be negatively affected.

Answers

D. The lung's capacity for oxygen will be negatively affected.

The lung has a capacity of a about 5L this will decrease becuase the mass will obstruct the airway.

Answer:

D. The lung's capacity for oxygen will be negatively affected.

Explanation:

Which one is it I need help?

Answers

answer a is correct

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

2. Tell the difference between the following
- Llittoral zone/limnetic zone
- photic/aphotic zone
- lake/wetland
- freshwater marsh/swamp/bog
- intertidal/neritic/open ocean zone

Answers

Answer:

1. littoral zone is a zone where lives continue after dead.

2. Photic zone is the zone where light Ray's give out to all plants.

2b. aphotic zone is a zone below where light absent.

3. Lake/wetland is a part of land where water is cover or absolutely moist in it nature.

What are the two categories that Igneous Rocks can be classified into?
How do you tell them apart?

Answers

Igneous rocks are divided into two groups, which penetrate or expand, depending on the strength of the molten rock.

Intrusive Igneous Rocks: Intrusive, or plutonic, is an empty rock that occurs when magma is trapped in the depths of the Earth.Extrusive, or volcanic, igneous rock is produced when magma exits and cools above the Earth's surface.

hope it helps!

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

(HELP WANTED AUTOMATIC BRAINLY) Which statement describes how the muscular and skeletal systems cause parts of the body to move?
A. When a muscle relaxes, it causes a bone to shorten.
B. When a bone shortens, it lengthens the muscle attached to it.
C. When a bone bends, it pushes a muscle in the opposite direction.
D. When a muscle contracts, it pulls a bone in one direction.

Answers

Answer:

C.

Explanation: Because when a bone does bend the muscles pull back so the bone doesnt dislocate.

The statement describes how the muscular and skeletal systems cause parts of the body to move is when a muscle contracts, it pulls a bone in one direction.

What is skeletal system?

The skeletal system is the in charge of all the bones and skeleton of the body. The skeletal system provides structure and strength to the body and protects the soft tissues.

The muscular system and the skeletal system work together as the muscles and bones are connected with each other.

Thus, the correct option is D. When a muscle contracts, it pulls a bone in one direction.

Learn more about the skeletal system, here:

https://brainly.com/question/1283837

#SPJ5

PLZ HELP (30 POINTS)




Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing?

Reducing soil degradation
Inventing new fertilizers
Updating irrigation
Increasing climate change

Answers

Answer: The answer is D Increasing climate change

Explanation: Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing? hope this helps man

D

Explanation:

i think that's the answer

According to the graph below, at which point is the plant preforming the most photosynthesis?

A. Point D.
B. Point B.
C. Point C.
D. Point A.

Answers

Answer: C

Explanation:

Point c would be the answer to your question

how would you classify the bloody fingerprint found in the pedro ramon velasquez case?
patent
latent
delta
plastic

Answers

Answer:

patent

Explanation:

Based on the graph in Figure 2, identify the environmental conditions (flower density AND proportion of deep flowers) where a short- tongued bee has the greatest relative advantage over a long tongued bee. Based on the graph in Figure 2, identify the range of proportion of deep flowers at which a long tongued- bee always has an advantage over a short tongued bee.

Answers

Answer:

The correct answer would be - low flower density and low deep flower proportion

Explanation:

To find the environmental conditions for a short-tongued bee has the greatest relative advantage over long-tongued bees it is required to find the highest value of relative advantage short-tongued bees has on long-tongued bees which is the point where flower density and deep flower proportion is lowest (near the zero) according to the graph. That is represented in the graph by the peak in the white shaded portion.

To find the range of deep flower proportion at which a long-tongued bee has an advantage take a closer look to the grey shaded area where if the deep flower proportion move from 0.6 to 1 the advantage of long-tongued bees over short-tongued.

Floral density with the graph shows the low flower density and low deep flower proportion. Floral density often influences the species composition of flower visitors.

This variation in visitor species composition has significant effects on pollination success and plant fitness, poorly understood, especially in the many pollination guilds dominated by non-territorial species.

How do flower visitors diverse the traits?

It explores how flower visitors with diverse traits should distribute themselves across resource patches differing in floral density.

The model predicts that species with low flower search speeds and low flower handling costs compared to competitors will usually dominate dense flower patches.

In addition, amongst flower visitors that have lower energy expenditure rates while handling flowers than while traveling, species maximizing energetic efficiency are associated with dense flower patches.

Therefore, the correct answer is low flower density and low deep flower proportion.

Learn more about the flower density here:

https://brainly.com/question/11253692

which factor would increase the production of glucose by photosynthesis

Please help!!!

Answers

Answer:

freezing temperatures

The amount of sun it’s getting

11. Peripheral membranes are located

Answers

Answer:free point

Explanation:

The answer for the question is free point

What traits might transfer across generations within animal species?

Answers

biological fitness or darwinian fitness there the same thing

Why are online banks becoming more popular?

Answers

Answer:

Online banks are becoming more popular because people don't want to get out of there house and also because of the virus

Explanation:

Hope this helps an also can I have a brainliest

How is the DNA code itself a homology?

Answers

Answer:

Explanation:

These fundamental similarities are most easily explained by evolutionary theory: life shares a common ancestor. ... In fact, the DNA code itself is a homology that links all life on Earth to a common ancestor. DNA and RNA possess a simple four-base code that provides the recipe for all living things.

Answer:

the DNA code itself is a homology that links all life on Earth to a common ancestor. DNA and RNA possess a simple four-base code that provides the recipe for all living things.

Which American Indian group was allied with the British as the French and Indian War began?
A)the Huron
B)the Ottawa
C)the Iroquois Confederacy
D)the Algonquin

Answers

Answer:

The Iroquois Confederacy would be your answer.

hope it helps!

Which of the following problems are a result of acid deposition?


Nitrogen depletion in soils
Decreased pH levels in lakes and rivers
Corrosion of monuments and metal structures
I and III
II and III
I only
II only

Answers

Answer:

II and III

Explanation:

Acid will decrease pH levels in water and corrode monuments like marble statues and rust metals, but has no correlation to nitrogen depletion.

Hope this helped!

Other Questions
how many atoms are in a sample of uranium with a mass of 789 g. A mass of 25kg is acted on by two forces, one which is 15 N due east while the second one is 10N due north . The acceleration of the mass is. Plz help Im getting timed help asap Its distributive property so 6x55 i need the second part how to write it out like (and then) a number + some other number and then what it equals 5th grade math please help me on this! thanks. I WILL GIVE BRAINLIEST I AM TIMED PLEASE HELPGive the opposite of the following meaning:donnersentiroffrirrecevoirmanger Read this passage from "August Heat" and think about what it tells the reader about the theme of the story:I rolled up the sketch, and without quite knowing why, placed it in my pocket. Then with the rare sense of happiness which the knowledge of a good thing well done gives, I left the house.What theme do these details about James suggest?Question 7 options:People should take good care of their possessions. Working hard is an important life skill.Many times we do things that are out of our control. Calculate the measure of ABC to the nearest tenth of a degree. Which best explains parallel forces?left and right forces that can be added togetherright and upward forces that cancel each other outaddition of parallel forces that cannot result in a negative forceleft and downward forces that cancel each other out What can historians learn from artifacts? Solve for X : 8x + 3 = 2x TRANSPORTATION The cost of riding in a cab is $3.00 plus $0.75 per mile. The equation that represents this relation is y=0.75x+3, where x is the number of miles traveled and y is the cost of the trip. Find and interpret f(17). You just found out you have to move out of state.Give an optimistic perspective and a pessimistic perspective. 78/329 times 890/2800 (900/322 x 780/900) Factor the expression completely6x-4x-16x Which sentence from the excerpt is an example of foreshadowing?A. As they suddenly start toward the house.B. In this brief fraction of a moment they take the first step toward performing a metamorphosis that changes people from a group into a mob.C. They begin to head purposefully across the street toward the house at the endD. The people stop as a group, seem to pause for a moment and then much more quietly and slowly start to walk across the street. What volume of 3.00 M HCl in liters is needed to react completely (with nothing left over) with 0.750 L of 0.100 M Na2CO3? 04.04 Jefferson Brings ChangeArticle TemplateArticle Title (Relate to the Event):Newspaper (Make Up a Name):Reporter (Your Name):Copyeditor (Your Parent or Guardians Name):Editor (Your Instructors Name):Date:First Step: Hook your reader into wanting to read your article. You could tell a story or use a quote. You might relate the past to modern events or your readers lives. Introduce the event and basic facts like people and places. Use at least three to five sentences.Second Step: Discuss one reason why the event is so important. Use facts to back up your idea.Third Step: Discuss a second reason for the events importance. Use facts.Fourth Step: Discuss a third reason for the events importance. Use facts.Fifth Step: This is where you summarize and review what you wrote. The sum of two numbers is 60. One number is 4 times as large as the other. What are the numbers? Larger number: Smaller number: The Founding Fathers created a government with a system of checks and balances in order to - Select one: Oensure that the executive branch would have the most power Oprotect against one branch dominating O make elected officials accountable