Answer:
The condition in which an allele is dominant over another allele is dominance
this part too #stresscrying
Explanation:
It could be that both the parents were heterozygous, meaning having a dominant and recessive allele for example Aa..after these are paired you would see that they will form a white fur offspring.
Nancy visits a local reservoir where she feeds ducks and other birds. Every time she feeds them she notices that they fight for the best pieces and some do not get any. All living things struggle to get the necessary amount of food, water, and shelter. What is the term for this struggle?
A. overproduction
B. natural selection
C. variation
D. competition
If a plant develops a toxin, how
might a herbivore evolve in
response?
A. The herbivore will most likely change its diet.
B. The herbivore will eat the plant until it
becomes immune.
C. The herbivore will gradually evolve a
resistance.
Answer:
a
Explanation:
It will probably change it's diet
Answer: A the herivabore will change its diet unless the plant in question is a fundamental key to its survival that C the herbivore will gradually evolve a resistance but the answer would be A as this is not explained in the question.
The similarity of the structures shown in the picture suggests that the organisms_______
1) have a common ancestor
2) all grew at different rates
3) live for a long time
4) evolved slowly
Which features form along all types of plate boundaries?
Hurry up!!
Explanation:
Ocean ridges features form along all types of plate boundaries.
helpp mee pleaseeee need help
Answer: it will increase the frequency of the action potential hope this helps
Explanation:
Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts
Answer:
Name one waste substance the coronary veins will remove.
…………………………………………………………………………………………………..……………………
what are the four primary uses or benefits of the nguni breed amongst South African communities?
Answer:
Utility: The Nguni cattle are used for milk and meat; their socio-cultural functions are also important. The body conformation of the Nguni is more of a dairy than beef type but it is principally used for beef production and for work.
Explanation:
Which student provides the best explanation of how to determine whether Cell A or Cell B is a plant or animal cell? Rusty- "cell A is an animal cell because it contains more organelles than a plant cell, Cell B" Kristin- "Cell A is a plant call because it has large vacuole in the middle of the cell to provide support, structure, and storage for the cell" Darryl- " Cell B is an animal cell because it has nucleus" Eleanor- " Cell B is a plant cell because is has a larger cytoplasm then cell A which stores a plants water and minerals."
Answer:
Kristin's answer is the best.
Explanation:
It is the only correct answer.
The student that best explains whether Cell A or Cell B is a plant or animal cell is Kristin who said that "Cell A is a plant call because it has large vacuole in the middle of the cell to provide support, structure, and storage for the cell".
Distinctive features of plant and animal cellsCell is the structural and functional unit of the living organism which contains organelles that carry out specific functions.
The plant cells can be distinguished from an animal cell through the following features:
it possess a larger vacuole which is centrally placed and helps in the storage of cell wastes.It possess cellulose cell wall that provides support and structure to the cell.They also possess chloroplasts which are not seen on animals cells.Therefore, the student that best explains whether Cell A or Cell B is a plant or animal cell is Kristin who said that "Cell A is a plant call because it has large vacuole in the middle of the cell to provide support, structure, and storage for the cell".
Learn more about cells structure here:
https://brainly.com/question/6350862
In your own words, can you explain where a hot
spot can be found AND what does it looks like?
Answer:
well for one you can find a lot for examples like if the light of a blazing hot sun was reflecting on a wooden stick the spot where the sun is reflecting would have a red mark with smoke comming out the stop
Tara, a server, has a sore throat. She takes her temperature and it reads 100°F. She should be _____.
excluded from work
allowed to continue her duties as long as she does not start to feel worse
reported to the health department
restricted from working with food
Can someone pls answer these multiple-choice questions, will mark as brainliest.
2. The formation of male and female sex cells is known as
A) gametogenesis
B) budding
C) sporulation
D) regeneration
Answer:
A . the formation of male and female sex cell is known as gametogenesis
Investiga un uso beneficioso (medicina o industrial) para las bacterias, virus y Hongos microscópicos. Explica brevemente su utilización.
Answer:
- Hongos: antibiótico penicilina
- Bacterias: producción de insulina para uso humano
- Virus: vectores basados en adenovirus para el desarrollo de vacunas
Explanation:
Los microorganismos son fundamentales para el desarrollo de diferentes tipos de aplicaciones industriales y medicinales. Por ejemplo, la penicilina es una sustancia sintetizada por el hongo Penicillium notatum, la cual es ampliamente utilizada como antibiótico debido a sus propiedades antibacterianas. Las penicilinas son antibióticos del grupo de los betalactámicos que tienen como núcleo un anillo central de beta-lactama, las cuales son capaces de destruir una amplia variedad de bacterias. Por otra parte, las bacterias pueden ser usadas para la generación de moléculas orgánicas con fines médicos. Por ejemplo, cepas de Escherichia coli han sido modificadas mediante técnicas de ingeniería genética con el objetivo de producir insulina humana, una hormona central en el metabolismo de la glucosa. Mediante técnicas de recombinación genética, el gen responsable por sintetizar insulina humana ha sido introducido en bacterias. Las cepas de E. coli son relativamente fáciles de cultivar en el laboratorio y por lo tanto permiten obtener grandes cantidades de esta hormona (insulina). Finalmente, existen ciertas tipos de virus inocuos para nuestro organismo los cuales han sido recientemente utilizados como vectores para el desarrollo vacunas. Mediante esta técnica de ingeniería genética, un determinado vector viral (por ejemplo, un virus de la familia de los adenovirus) es modificado genéticamente con el objetivo de insertar un fragmento de un agente infeccioso o 'antígeno' el cual individualmente es incapaz de producir daño. Las vacunas diseñadas a partir de vectores virales son inofensivas para el organismo pero son capaces de desencadenar una respuesta inmune contra el antígeno recombinante, generando de este modo una memoria inmunitaria en contra el agente infeccioso.
what is the smallest unit of DNA molecule that can be altered by a mutation and cause a change to the coding of polypeptide
sources of potassium for plants
Answer:
mined rock powders and wood ash.
Explanation:
Graduate students monitoring the benthic organisms of a freshwater lake take samples at different depths throughout the lake and identify the invertebrate species present. In a deep region of the lake, they discover a crustacean that appears to be a new species. They decide to study its natural history. What is the first thing they should do in this study?
Answer:
Do a literature search to find natural history information on closely related species.
Explanation:
In the context, few graduate students monitored the benthic organisms from the fresh lake water samples and identified the invertebrate species that are present.
They also discover a crustacean which appears to be the new species for which they decided to do a study on its natural history. The first thing that the graduate student should do is to do a literature search for finding a natural history on the information that are closely related species.
¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada
Answer:
D.Grupos taxonomicos
Explanation:
Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.
Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.
El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.
Proteins secreted by Gram-negative cells face multiple obstacles, including _____. Multiple choice question. moving across the periplasmic space underlying the thick peptidoglycan layer of the cell wall moving across the plasma membrane moving across the plasma membrane and the thick peptidoglycan layer of the cell wall moving across both the plasma membrane and the outer membrane
Answer:
moving across both the plasma membrane and the outer membrane
Explanation:
Gram-negative bacteria are bacteria that have a plasma membrane, a thin peptidoglycan layer, and an outer membrane (the space between the plasma membrane and the outer membrane is known as periplasm). Moreover, Gram-positive bacteria exhibit neither outer membrane nor periplasmic space and are surrounded by thick layers of peptidoglycan. Gram-negative bacteria have developed different protein secretion systems (types I–VI and type VIII) in order to secrete proteins into the extracellular space. For such purpose, the XcpQ protein (which is an outer membrane protein from the secretin family) participates in different transport processes in Gram-negative bacteria.
What is the main function of the central nervous system ? E2020
Answer:
The central nervous system (CNS) controls most functions of the body and mind. It consists of two parts: the brain and the spinal cord. The brain is the center of our thoughts, the interpreter of our external environment, and the origin of control over body movement.
Explanation:
Answer:
Main function-the interpreter of the environment and control over body movement.
The central nervous system controls the body and mind. It has two parts, the brain and the spinal cord. The brain is the center of thoughts..
Compare photosynthesis and cellular respiration. In what types of cells do these processes occur?
Answer:
Cellular respiration occurs in both plants and animals.
But photosynthesis occurs only in plants. But photosynthesis can happen to 4 animals. It is only an exception, however. Sea slug and pea aphid may perform photosynthesis, oriental hornet, spotted salamander.
Explanation:
ATP is the main energy source of the cell. The most important final product of cellular respiration.The two main final photosynthesis products are glucose and oxygen.
Some of the cellular respiration enzyme reactions occur in the cytoplasm but the bulk is in the mitochondria. Inside the chloroplast, photosynthesis occurs.NADH is the high-energy cellular respiration electron carrier, while NADPH is photosynthesized as a powerful electron carrier.In the cell chloroplasts, photosynthesis is carried out. This process gives energy directly or indirectly to all living organisms. Life on Earth would be no longer there without it.
Although photosynthesis needs energy and produces food, cellular breathing breaks food down and releases energy. Photosynthesis and respiration are carried out by plants while animals can only breathe.
Pls help this is due today
Answer:
scientific method can help resolve problems logically
Answer:
b. scientific
Explanation:
the method most talked about in science is the scientific method. I've never really heard of any of the other methods, they don't make sense with the question anyway.
hope this helps! lemme know if you need more
which of the following involves mitotic cell division.
a. production of a fertilized egg
b. sexual reproduction
c. asexual reproduction
d. production of gametes
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
I have no clue and the internet doenst help
Answer:
Soda
Explanation:
These are some weird questions...
I would say the canned soda since machines do most of that work anyway, while things like livestock need more human interaction, meaning more work needs to be done.
Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms
B. bacteria
C. aliens
D. related
Answer:
Hi, there the answer is D. related
Explanation:
Homologous structures are similar structures in related organisms.
Hope This Helps :)
Answer:
it is d i think
Explanation:
Which statement is true about gene expression? Give brainlist is answer right
Cells become specialized because different cells contain different sets of genes
Gene expression occurs primarily when DNA is replicated before the process of mitosis
The DNA of repressed genes gets destroyed because it is not being used
A cell becomes specialized by controlling the which proteins are produced from the cell's DNA
Answer:
I guess All of them
Explanation:
Gene expression has all of these statements as given above in text.
Those who argue that objectivity is impossible are known as activitists.
O True
O False
ASAP
AND THANK YOU
5.
Name three factors that may affect the carrying capacity of the population. (3 points)
What is anatomy?
Simple answer please!
I'll give brainlist
Answer:
Anatomy is the study of the bodies of people and other animals
hope this helps
have a good day :)
Explanation:
Anatomy is the branch of biology concerned with the study of the structure of organisms and their parts. Anatomy is a branch of natural science which deals with the structural organization of living things. It is an old science, having its beginnings in prehistoric times.