10. If the red allele is incompletely dominant to the white alle
individual's phenotype be?

Answers

Answer 1
If RR Is red, and rr is white, Rr is pink. Incomplete dominance is a mixing of traits.

Related Questions

how does urbanization cause air pollution​

Answers

.Answer:Concentrated energy use leads to greater air pollution with significant impact on human health. Automobile exhaust produces elevated lead levels in urban air. Large volumes of uncollected waste create multiple health hazards. Urban development can magnify the risk of environmental hazards such as flash flooding.

Explanation:

How can i earn money from this app?

Answers

Answer:

u dont earn money from brainly. the point is altruistic help

Explanation:

if u mean something else, provide context and ill leave a comment with the correct answer

Need help right now can’t figure it out

Answers

Answer:

[tex]\huge\boxed{Alkane.}[/tex]

Explanation:

The given compound is an alkane because all the bonds between carbon are single. Alkanes have all single bonds and are thus called saturated hydrocarbons.

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

In which of the following ways can albert reduce the resources he consumes

Answers

Answer:

where is option man?

please,send option also

I want a sister I can’t live like this with my parents

Answers

[tex] \large \sf{ah ! \: now \: what \: you \: will \: do?} \\ \large \sf{what \: did \: you \: decide?}[/tex]

Pandas eat bamboo for energy. What are pandas classified as

Answers

Answer:

A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.

Explanation:

A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.

Answer: consumers

Explanation: I took the test on edg

A white woman says she is not racist but avoids sitting near Black individuals. She has

A.high explicit racism, low implicit racism
B.high explicit racism, high implicit racism
C.low explicit racism, low implicit racism
D.low explicit racism, high implicit racis

Answers

I believe it is A
Please make this the brainliest answer

This part of a plant cell makes the process of photosynthesis possible.
Chloroplast
O Mitochondria
O Centrioles

Answers

The chloroplast is the organelle of a plant cell that makes the process of photosynthesis possible.

Photosynthesis refers to the metabolic reactions by which plant cells synthesize simple carbohydrates (glucose) by using the light energy from the sun and carbon dioxide.

Photosynthetic reactions can be divided into light-dependent reactions and light-independent reactions.

During photosynthesis, light-dependent reactions occur in the thylakoid membranes of chloroplasts.

In conclusion, the chloroplast is the organelle of a plant cell that makes the process of photosynthesis possible.

Learn more about chloroplasts here:

https://brainly.com/question/2512051

Plant and animal cells are both eukaryotic. This means they...
O Have a nucleus
O Contain DNA and RNA.
O Can reproduce on their own.

Answers

the answer is the first one they both have a nucleus!

Determine if these statements are true or false: Introns represent a genome scrap
yard that provides DNA segments for genome evolution and a variety of small RNA
molecules
the RNA polymerase transcribes the DNA template it does so by
creating Okazaki fragments in one direction and a continuous strand on the
opposite direction
FALSE; FALSE
TRUE; FALSE
TRUE; TRUE
FALSE; TRUE

Answers

i think the answer would be: #2 - true; false

Deana applies the data in the table to calculate the rate of population increase or decrease of each country. Which assumption is necessary for Deana’s calculations to be accurate?

Answers

It should be noted that population is simply used for the determination of the economic activity of an area or country.

Your information is incomplete. Therefore, an overview of population will be given. Population simply means the inhabitants of a particular place or the number of organisms living in an area.

The increase or decrease in the rate of population is calculated by the formula:

= (New population - Old population) / Old population × 100

Learn more about population on:

https://brainly.com/question/13403673

I hate my biology teacher but he’s such a D.a.d.d.y

Answers

Answer: Dam

Explanation: Dammmmmmmmm

Abagnale's life could best be paraphrased as...​

Answers

Answer:

running from the law and later working for  the law.

Explanation:

Frank Abagnale Jr. is the clear example of a boy who makes mistakes when trying to progress quickly without caring about his crimes, among which are the falsification of documents and checks, as well as the illegal practice of professions, which is why which during his youth had to flee from justice, however, due to the expertise he obtained after creating many false checks and his criminal journey, the American government gave him the possibility of working with them, contributing his knowledge of possible techniques fraud and help counter it, which was paradoxical considering his background.

Ba
Regarding cell walls, which of
these is the MOST accurate?
im
A. Cell walls and cell membranes are the very
same thing
B. Cell walls burst any time the cell takes in too
much water.
C. Cell walls keep a plant, bacteria or fungus cell
from bursting when too much water is absorbed

Answers

Answer:

C

Explanation:

cell wall

When water moves into a plant cell, the vacuole gets bigger, pushing the cell membrane against the cell wall. The force of this increases the turgor pressure within the cell making it firm or turgid . The pressure created by the cell wall stops too much water entering and prevents cell lysis.

what would happen to an organism if mitosis did not occur

Answers

If mitosis DID NOT happen... the organism would stay as a single cell. The life we know it now... wouldn't exist as we have multi-cellular stuff.

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

Select all of the following that correctly describe the Streptococcus genus
- Gram Negative
- Gram Positive
- Cocci
- Bacilli
- Tetrads
- Sarcinae
- Strepto
- Staphylo
- Fastidious
- Can grow in salt
- Can grow in acid
- Normal flora of the skin

Please explain if possible!

Answers

Gram Positive :

Streptococcus is a genus of spheroidal bacteria that belongs to the Streptococcaceae family.

The bacteria's distinctive clustering in chains that resemble a string of beads is referred to as streptococcus ("twisted berry"). Microbiologically, streptococci are classified as gram-positive and nonmotile. Cocci :

Streptococcus is a genus of gram-positive coccus (plural cocci) or spherical bacteria belonging to the Streptococcaceae family, which is part of the Lactobacillales (lactic acid bacteria) order in the Firmicutes phylum.

Gram-positive cocci are a diverse collection of bacteria that have a similar shape. Sarcina cells, for example, are grouped in cubical pockets. Streptococcus spp. resemble a string of pearls. Staphylococcus species do not divide on a regular plane.Bacilli :

Streptococcus bacteria subdivide into Strep. pyogenes (Group A), Strep. agalactiae (Group B), enterococci (Group D), Strep viridans, and Strep pneumonia. Gram-positive bacilli (rods) subdivide according to their ability to produce spores.

If complete hemolysis of the blood cells is observed, the streptococci are classified as beta'hemolytic. M protein is considered the most important virulence component of S. pyogenes. Antibodies that react with M protein are produced in response to infection. A prospective antistreptococcus vaccination based on the M protein or a derivative of it is being studied.Tetrads :

The tetrad occurs in a subgroup of the cocci where the bacterium divides in two planes to form a square of four bacteria called a tetrad. Some examples of tetrad-forming bacteria are the lactic acid bacilli, Aerococcus, a urinary tract pathogen and Pediococcus and Tetragenococcus, both of which ferment foods.

Tetrads are groups of four cocci that are positioned in the same plane (e.g. Micrococcus sp.). Sarcina is a bacterial genus that consists of eight cocci arranged in a cuboidal pattern (e.g. Sarcina ventriculi).Sarcinae :

Sarcina is a Gram-positive cocci bacterium genus belonging to the Clostridiaceae family. After the cuboidal (2x2x2) cellular affiliations they create during division along three planes, the genus gets its name from the Latin word "sarcina," which means "pack or bundle."

Diplococci are pairs of cocci; streptococci are rows or chains of such cells; staphylococci are grapelike clusters of cells; sarcinae are packets of eight or more cells; and tetrads are groups of four cells in a square layout. Variations in the reproductive mechanism of bacteria result in these distinctive groups.Strepto :

a combining term that means "twisted" and is used to make composite words: streptococcus

Streptococcus- a spherical or oval bacteria of the genus Streptococcus that occurs in pairs or chains and is harmful for humans, causing scarlet fever, tonsillitis, and other diseases.Fastidious :

Streptococcus is a genus of gram-positive cocci that are organized in chains. These are fastidious bacteria that need blood or serum added to their culture medium. They are non-motile and do not produce spores. Most are facultative anaerobes, which means they can grow on enriched media.

Streptococcus pyogenes - it's a nutrient-concious bacteria that ferments glucose to make lactic acid and has stringent growth needs. This section explains the growth and maintenance of S. pyogenes to help in the research of this organism.Can Grow In Salt :

On the basis of their salt tolerance, the salt tolerance test is used to identify enterococcal group D Streptococcus. Several bacteria, notably viridians streptococci, have been classified based on their capacity to thrive in the presence of a varying quantity of sodium chloride (NaCl).

The non-beta hemolytic streptococci (viridans, and non-enterococcal group D) do not grow in 6.5% NaCl broth; but some of the beta-hemolytic strains may grow in the broth.Can Grow In Acid :

Some streptococci can create acids, grow in acidic surroundings (acidophilia), make acids at low pH levels (aciduric capability), and synthesis intracellular and external polysaccharides.

Dental caries is associated mainly with acid production at pH values below 5 by nongrowing bacteria in dental plaque. Oral streptococci cannot grow at pH above about 5, although they can lower the pH of suspensions or biofilms to values of 4 or lower.Normal Flora of The Skin:

Bacteria make up the vast bulk of typical flora. Skin and nasal membranes are typically infected with Staphylococcus epidermidis.

Staphylococcus epidermidis is a Gram-positive bacterium that belongs to the Staphylococcus genus, which has around 40 species. It is found in marine sponges and is part of the normal human flora, most usually the skin flora and less commonly the mucosal flora.

Sources: ( https://www.cdc.gov/ )

What does saccharide mean?

lipid

base

acid

sugar

Answers

Saccharide is another term for sugar.

Imagine that the climate in your region became extremely arid, and freshwater became a scarce and precious resource. Wasteful uses of water, such as watering lawns and filling swimming pools, would be strictly outlawed, and water from the municipal water supply would cost 100 times what it does now. Discuss how you would adapt to that situation.

Answers

I would adapt to such situation by ensuring that physical activities are

reduced , use of water is adjusted and recycling is maximized.

Water is a n important component of life as we need water for various

activities such as drinking, cooking, washing etc. Scarcity of water can result

to unhygienic conditions and dehydration which could result in death.

it is best to ensure physical activities are reduced to prevent dehydration

through sweating. The wastage of water should be reduced to the barest

minimum through use adjustment and recycling.

Read more about adaptation on https://brainly.com/question/15118660

According to Hebrews 11, what did Abraham believe God would do if Isaac was slain as a sacrifice?

Answers

Answer: Isaac

Explanation:

Isabel is researching the effects of deforestation using online sources. She finds an environmental study on the relationship between deforestation and local weather. Which of the following characteristics should this study have in order for its results to be considered valid?

I. Empirical observations
II. Evidence that can be replicated
III. Outcomes that don't change with new experimentation

A. I and II
B. II and III
C. I and III
D. I only

Answers

Answer:

Here is something that might help you

Explanation:

I am not trying to plagiarize, just trying to help.

Learn more of where I got this answer at https://brainly.com/question/24430205?referrer=searchResults. Trust me, it is not a site that will steal any of your information, phone numbers, or passwords. I hope I helped.

Which type of cloud is made up of both liquid water droplets and ice crystals?

Answers

Answer:

Altostratus clouds are gray or blue-gray mid-level clouds composed of ice crystals and water droplets. The clouds usually cover the entire sky.

Explanation:

pls check help /edtrphzjbi​

Answers

Answer:

I don't get it but heres your answer

Explanation:

sharghvquvbOIQUugua

There you go!

PLEASE HELP WITH THIS ONE QUESTION

Answers

Answer:

Fourth option

Explanation:

ATP - Adenosine Triphosphate (3Ps), ADP - Adenosine Diphosphate (2Ps). ATP breaks down into ADP because it loses a Phosphate Anion in whatever process that the ATP is becoming ADP.

In the image provided, fourth image shows how ATP breaks down into ADP. Option D is the correct answer.

ATP (adenosine triphosphate) is a molecule that stores and provides energy for cellular processes. When ATP is used, it undergoes a process called hydrolysis, where a water molecule is used to break a high-energy phosphate bond in ATP. Option D is the correct answer.

During this hydrolysis process, one of the phosphate groups in ATP is cleaved off, resulting in the formation of ADP (adenosine diphosphate) and an inorganic phosphate (Pi). The energy stored in the phosphate bond is released, making it available for cellular functions. The breakdown of ATP into ADP allows the released energy to be utilized by cells for various activities, such as muscle contraction, active transport, and synthesis of molecules.

Learn more about Adenosine Triphosphate here:

https://brainly.com/question/897553

#SPJ2

Your skeleton enables you to move.


True
False

Answers

Answer:

True

Explanation:

Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Answer:

Allows movement: Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Explanation:

please mark my answer in brainlist

In the pregnancy time the embryonic cells are developed into different types of cells,tissues,organs How??​

Answers

Answer:

The embryonic stage plays an important role in the development of the brain. Approximately four weeks after conception, the neural tube forms. This tube will later develop into the central nervous system including the spinal cord and brain. The neural tube begins to form along with an area known as the neural plate.

Explanation:

Granite is an intrusive igneous rock with large crystals because it cools slowly. Where was this rock most likely formed ?

A - in a river
B - deep inside a volcano
C- in a mountain range
D- on the surface of a volcano

Ik the answer is not c
Can someone help me figure this out plz and thank you

Answers

Answer: D

Explanation: Because rock cools on the surface of the volcano and I know because I learned about volcanoes and I went through the topic.

Granite is an intrusive igneous rock with large crystals because it cools slowly. this rock most likely formed on the surface of a volcano. thus option D is correct.

What is rock cycle ?

Rocks are naturally occurred on non-living earth which are made by collection of  mineral grains held together in a firm, it can be tiny or big as well and can be easily identified with their texture.

The Rock cycle can be defined as a continuous process through which old rocks are transformed into new rock due to cool down of molten magma, when it solidifies become igneous rock.

In a rock cycle, when the break down of these igneous rocks occur  small particles that are transported and deposited to form sedimentary rocks,  When the igneous and sedimentary rocks heated up and under the pressure they change into metamorphic rocks.

The metamorphic rocks which are subjected under great heat and pressure melt down to form molten magma which again can cool down and solidify into igneous rocks

For more details regarding rock, visit

brainly.com/question/9243222

#SPJ2

How does the carbon stored in the bodies of living organisms move into rocks?(1 point)

Carbon dioxide released through respiration dissolves in certain rocks, like limestone.

Living organisms decay, releasing carbon into the soil, and soil is compacted into rocks.

Living organisms decay and become fossils fuels, which eventually become rocks.

Carbon dioxide dissolves in ocean water and is slowly absorbed by rocks in the ocean.

Answers

In the atmosphere, carbon is stored in the form of gases, such as carbon dioxide. ... This carbon can then be ingested and stored in animals that eat the plants. When the animals die, they decompose, and their remains become sediment, trapping the stored carbon in layers that eventually turn into rock or minerals.

When animals die, their bodies degrade into the soil, encasing the carbon in layers that eventually transform into rock or minerals. hence option b is correct.

What is rock?

Stone including limestone and its minerals is created when sediment and shell layers are bonded together over time.

Gases like carbon dioxide are among the forms of carbon that are stored in the atmosphere. Animals that consume the plants can then absorb and store this carbon.

When animals die, their bodies degrade into silt, encasing the carbon in layers that eventually transform into rock or minerals. Some of this silt may eventually turn into fossil fuels like coal, oil, or natural gas, which when burned, release carbon back into the atmosphere.

Therefore, when an animal dies to decompose into the soil which becomes rocks through carbon from living organisms moves into rocks, hence option b is correct.

Learn more about rocks, here:

https://brainly.com/question/23464190

#SPJ2

Which of these could be a consequence of a mutation in one of an organism's
sex cells?
O A. The loss of the organism's ability to reproduce
B. The disruption of protein synthesis in the organism
O C. The transfer of the mutation to one of the organism's offspring
D. The ultimate death of the organism

Answers

Answer:

c

Explanation:

When an egg and a sperm cell unite, the resulting fertilized egg cell receives DNA from both parents.

I need help solving this for my homework please and thank you

Answers

Answer: chromosomal replication

Explanation:

Other Questions
I need help on this i would love that because i suck at this stuff... Read the excerpt from "Justin Lebo.It was a BMX bike with a twenty-inch frame. Its original color was buried beneath five or six coats of gunky paint. Now it showed up as sort of a rusted red. Everythingthe grips, the pedals, the brakes, the seat, the spokeswere bent or broken, twisted and rusted.The author most likely included these details in order to?A.highlight the amount of money Justin had to spend to restore the bicycle.B.illustrate why Justin wanted to give the bicycle away to someone else.C.emphasize how hard Justin had to work to restore the bicycle.D.show why Justin may have made a mistake in buying this bicycle. Interest earned: $76Principal: $800Interest rate:?Time: 2 years 7. Who do you call a historical personality? Give a few examples. Which of the following statements are true about implementing corporate change?. Find the value for x (x+20) (4x-5) The table shows values for a linear function, f (x ). What is an equation for f (x )?Select the two values into the correct location. Explain the reason that maps must change over time hlep me it is easy plssssssssssssss Compare. A. C. = PLEASE HELP ME!!The molar mass of BF3 is 67.81 g/mol. How many molecules of BF3 are there in 2 g? (1 point)A) 1.776 x 1022B) 8.881 x 1021C) 1.204 x 1024D) 4.084 x 1025 Define gamete and zygote. What number of chromosomes does each have? How does the Coriolis effect impact the Gulf Stream and the Brazil Current?It turns the Gulf Stream southwest and the Brazil Current northeast.It turns the Gulf Stream northwest and the Brazil Current northeast.It turns the Gulf Stream northeast and the Brazil Current southwest.It turns the Gulf Stream northeast and the Brazil Current northwest. brief summary of conservation of forests & wildlife least 10 page 13. Which scenario most likely formed most largelakes in North America and Europe? please help.with the steps.just b, please express the following fractions as the sum or difference of two fractions (x^2+y^2)/x^4 Hydrochloric acid and sodium hydroxide react to produce water and sodium chloride in endothermic reaction. Which statement must be true of the reaction? A. more bond energy is absorbed on the reactants side than is released on the products side.B. The energy of each bond in water and sodium chloride is greater than the energy of each bond in hydrochloric acid and sodium hydroxide C. The bond energy used to break the bonds in hydrochloric acid in the sodium hydroxide is less than the energy released to from the bonds in water and sodium chloride.D. The total energy of wster and sodium chloride is greater than the total bond energy of hydrochloric acid and sodium hydroxide. the structures created at convergent boundaries under the ocean are different than the structures created at those boundaries on land. which statement describes this difference? For question 1, find the x- and y-intercept of the line.-10x -5y=40A. x-intercept is 5; y-intercept is -10B. x-intercept is 8; y-intercept is -4C. x-intercept is -10; y-intercept is 5D. x-intercept is -4; y-intercept is 8